The sarcomeric protein titin plays a central role in thick filament structure and function through its modular A-band domains, including the understudied P-zone, which links the C-zone to the M-band. To investigate the first four domains of titin’s P-zone (A164–A167), we deleted them in a mouse model (TtnΔA164–167). Echocardiography and cardiomyocyte mechanics revealed mild changes to diastolic function and enlargement of the heart, but preserved contractility. The EDL muscle showed contractile deficits at the whole muscle level and increased passive stiffness at the myofiber level. Immunoelectron and super-resolution microscopy revealed altered thick filament architecture, including a ∼40-nm shift of titin and myosin binding protein-C epitopes toward the M-band, disruption of titin’s α and β conformations, and shorter thick filaments. The structural changes are consistent with the loss of a myosin helical repeat. These findings establish a key structural role of titin’s P-zone domains A164–A167 in templating thick filament protein arrangement, including the importance of titin’s α and β conformations.
Introduction
The striated muscle sarcomere is a fine-tuned lattice-like structure composed of thin filaments, thick filaments, and titin filaments (Wang et al., 2021). The myosin-based thick filament, into which titin incorporates, is tightly regulated structurally and functionally, such that the myosin heads maintain precise spacing, orientation, and intermolecular interactions throughout the filament (Houmeida et al., 1995; Jung et al., 2008). Titin’s A-band contains super-repeating units of immunoglobulin-like (Ig-like or Ig) and fibronectin type III (FnIII) domains connected by short, 3–4 residue linkers (Fleming et al., 2023; Bang et al., 2001; Bucher et al., 2010). At the distal region of the thick filament, titin’s D-zone contains 6 super-repeats of 7 domains each, while the C-zone contains 11 super-repeats of 11 domains each (Labeit and Kolmerer, 1995) (see Fig. 1 A for details). In the C-zone, the length of the titin super-repeats matches that of the myosin helical repeat and the spacing between myosin binding protein-C (MyBP-C) molecules, 43 nm (Tonino et al., 2019; Bennett et al., 2020; Squire et al., 2004; Craig and Offer, 1976b). Titin has long been considered a “molecular ruler” or “template” for the thick filament and has been shown to dictate thick filament length by its C-zone super-repeats (Tonino et al., 2017), but not its I/A junction at the outer edges of the thick filament (Granzier et al., 2014). Whether the D-zone contributes to thick filament length control remains to be tested.
An anatomical diagram labeled A illustrates the complex structure of a sarcomere and the protein titin, breaking it down from a macro to a molecular level. At the top, a full sarcomere is shown with purple titin filaments anchored to the Z-discs at both ends, flanking a central orange thick filament and peripheral tan thin filaments. Dotted lines zoom into a single titin strand, which is depicted as a horizontal chain of colorful oval domains. This strand starts at the M-band on the left with blue and purple segments, moves into a P-zone consisting of alternating white and purple ovals, continues through a C-zone (x 11) of white ovals with occasional purple markers, and ends at a D-zone (x6) of white and purple ovals on the right. A final zoom-in focuses on a specific section of the P-zone, revealing seven individually labeled oval domains. From left to right, these are labeled A 170 (white), A 169 (purple), A 168 (purple), A 167 (white), A 166 (white), A 165 (purple), and A 164 (purple). A diagram labeled B illustrates the interaction between muscle protein filaments in a detailed view. At the top, a thick orange filament features several curved, protruding myosin heads that reach upward. Below this, two parallel strands of the protein titin, labeled as Titin alpha and Titin beta, are depicted as chains of oval domains. Titin alpha, the bottom strand, consists of alternating purple and white ovals with a single blue circle on the left side. Titin beta, positioned between the orange filament and Titin alpha, also displays purple, white, and blue domains. Notably, a section of the Titin beta strand loops upward and wraps around the orange thick filament, with its white and purple domains coming into direct contact with the orange structure. The graph labeled C shows the data for the Left Ventricle. The vertical axis represents P S I (percentage) and ranges from 0 to 100 with increments of 10. The horizontal axis represents the Exon number, ranging from 0 to over 350 with increments of 50. Above the plot area, the gene structure is divided into functional regions: Z-disk, I-band, A-band, and M-line. Two lines are plotted: a gray line for W T (Wild Type) and a blue line for Ttn Delta A164-167. In this graph, the gray and blue lines almost perfectly overlap across the entire range. P S I values are near 100 percent for the Z-disk (exons 0–50), drop to near 0 percent for most of the I-band (exons 50–220) with a notable peak around exons 100–120 reaching 60 percent, and return to near 100% for the A-band and M-line (exons 220–360). There are sharp, narrow downward spikes near exon 10 and exon 355, where P S I drops significantly. Graph D shows the data for the Extensor Digitorum Longus skeletal muscle. The axes and increments are identical to Graph C, with the vertical axis showing P S I (percent) from 0 to 100 and the horizontal axis showing Exon numbers from 0 to 350. In this graph, there is a visible divergence between the gray W T line and the blue Ttn Delta A164-167 line. While both start at 100 percent in the Z-disk, the blue line shows a slight dip to 85 percent around exons 50–75. Significant differences occur in the I-band region: between exons 130 and 160, the blue line drops sharply to near 0 percent several times, while the gray line maintains higher P S I values (averaging 40–80 percent). Between exons 170 and 210, the gray line shows a broad peak reaching 90 percent, whereas the blue line remains at 0 percent for that entire section. Both lines converge back to nearly 100 percent for the A-band and M-line starting around exon 220, though both show a sharp drop to 0 percent at exon 355. The image labeled E compares protein expression in the L V (Left Ventricle) and E D L (Extensor Digitorum Longus) muscles. In the Left Ventricle panel, the protein bands represent the cardiac isoforms of titin. Near the top of the gel, there are two distinct high-molecular-weight bands: N 2 B A (the upper, fainter band) and N 2 B (the lower, much darker and more prominent band). The band patterns for both the W T and the Ttn Delta A164-167 mutant appear virtually identical in intensity and position. Further down the gel, a mid-range band labeled T 2 (a titin degradation product) is visible, followed by a very thick, dark loading control band at the bottom labeled M H C. The E D L panel shows the protein profile for skeletal muscle, which differs noticeably from the cardiac panel. The top-most bands are labeled N 2 A and N 2 A-2. While the W T lane shows a clear, thick N 2 A band, the mutant Ttn Delta A164-167 lane shows an N 2 A band that appears slightly shifted or thinner, accompanied by changes in the lower bands. Below the primary N 2 A bands, there are several intermediate bands that are more numerous and distinct than those seen in the L V panel. The T 2 band is positioned similarly to the L V panel but appears slightly more defined. At the very bottom, the M H C band serves as a consistent loading reference, appearing as a thick, dark, horizontal block in both the W T and mutant lanes. The image labeled F is a bar graph representing the Optical Density (O D) Ratio for proteins in the Left Ventricle. The vertical axis ranges from 0.0 to 0.4 with increments of 0.1. Three pairs of bars compare W T (gray) and mutant (blue) for different protein ratios: N 2 B A/N 2 B, T T/M H C, and T 2/T T. Individual data points are plotted as dots over each bar, and error bars show the standard deviation. For all three protein ratios in the L V, the bars are of similar height, and each pair is marked with ns (not significant), indicating no statistical difference between the W T and mutant heart samples. The image labeled G shows the O D Ratio for the Extensor Digitorum Longus skeletal muscle. The vertical axis and increments are identical to Graph F (0.0 to 0.4). This graph compares two ratios: T T/ M H C and T 2/T T. For T T/M H C, the mutant (blue) bar is slightly higher than the W T (gray) bar, while for T 2/T T, the mutant bar is lower than the W T. However, both comparisons are labeled with n s, showing that these protein ratio changes in the skeletal muscle are not statistically significant. The image labeled H measures Grip Strength, plotted as Average Force per Body Weight (grams per gram). The vertical axis ranges from 0 to 6 with increments of 2. There are two bars: a W T bar (gray) and a Ttn Delta A164-167 bar (blue). The W T bar reaches an average value of approximately 4.0 grams per gram, while the mutant bar is significantly lower, reaching approximately 2.8 grams per gram. A bracket above the bars is marked with an asterisk, indicating a statistically significant decrease in grip strength for the mutant mice compared to the wild-type mice. All values are approximate.Genetically engineered mouse model lacking the first four domains of titin’s P-zone, A164–167. (A) Titin’s A-band is incorporated into the thick filament, with the P-zone linking the C-zone and M-band segments, spanning domains A164–170. Domains A164–167, which span 16 nm, were deleted in this mouse model. Ig domains: magenta; FnIII domains: white; titin kinase: purple; M-band M-is: blue. (B) Schematic of titin’s α and β conformations at the C-zone-to-P-zone transition region. (C) Titin exon usage in LV muscle from 3-mo-old TtnΔA164–167 mice (4 WT and 4 TtnΔA164–167 mice). (D) Titin exon usage in EDL muscle from 3-mo-old TtnΔA164–167 mice (4 WT and 4 TtnΔA164–167 mice). (E) Representative agarose protein gels of titin in LV and EDL muscles from WT (left lane in each pair) and TtnΔA164–167 mice (right lane in each pair). (F) For LV, the OD ratios of the N2BA to N2B titin isoforms (N2BA/N2B), total titin (TT, N2BA+N2B+T2) to MyHC, and T2 to total titin are plotted. (G) For EDL muscle, OD ratios of total titin to MHC (TT/MHC) and T2 to total titin (T2/TT) are plotted. Statistical significance was determined by an unpaired t test between WT and TtnΔA164–167 for each ratio. (H) Front-limb grip strength, measured in grams of force per grams of body weight, at 90 days of age. Each point is the average of three trials from one mouse; five WT and five TtnΔA164–167 mice were tested. ns, p ≥ 0.05; *p ≤ 0.05. Statistical significance was determined by an unpaired t test. OD, optical density. Source data are available for this figure: SourceData F1.
An anatomical diagram labeled A illustrates the complex structure of a sarcomere and the protein titin, breaking it down from a macro to a molecular level. At the top, a full sarcomere is shown with purple titin filaments anchored to the Z-discs at both ends, flanking a central orange thick filament and peripheral tan thin filaments. Dotted lines zoom into a single titin strand, which is depicted as a horizontal chain of colorful oval domains. This strand starts at the M-band on the left with blue and purple segments, moves into a P-zone consisting of alternating white and purple ovals, continues through a C-zone (x 11) of white ovals with occasional purple markers, and ends at a D-zone (x6) of white and purple ovals on the right. A final zoom-in focuses on a specific section of the P-zone, revealing seven individually labeled oval domains. From left to right, these are labeled A 170 (white), A 169 (purple), A 168 (purple), A 167 (white), A 166 (white), A 165 (purple), and A 164 (purple). A diagram labeled B illustrates the interaction between muscle protein filaments in a detailed view. At the top, a thick orange filament features several curved, protruding myosin heads that reach upward. Below this, two parallel strands of the protein titin, labeled as Titin alpha and Titin beta, are depicted as chains of oval domains. Titin alpha, the bottom strand, consists of alternating purple and white ovals with a single blue circle on the left side. Titin beta, positioned between the orange filament and Titin alpha, also displays purple, white, and blue domains. Notably, a section of the Titin beta strand loops upward and wraps around the orange thick filament, with its white and purple domains coming into direct contact with the orange structure. The graph labeled C shows the data for the Left Ventricle. The vertical axis represents P S I (percentage) and ranges from 0 to 100 with increments of 10. The horizontal axis represents the Exon number, ranging from 0 to over 350 with increments of 50. Above the plot area, the gene structure is divided into functional regions: Z-disk, I-band, A-band, and M-line. Two lines are plotted: a gray line for W T (Wild Type) and a blue line for Ttn Delta A164-167. In this graph, the gray and blue lines almost perfectly overlap across the entire range. P S I values are near 100 percent for the Z-disk (exons 0–50), drop to near 0 percent for most of the I-band (exons 50–220) with a notable peak around exons 100–120 reaching 60 percent, and return to near 100% for the A-band and M-line (exons 220–360). There are sharp, narrow downward spikes near exon 10 and exon 355, where P S I drops significantly. Graph D shows the data for the Extensor Digitorum Longus skeletal muscle. The axes and increments are identical to Graph C, with the vertical axis showing P S I (percent) from 0 to 100 and the horizontal axis showing Exon numbers from 0 to 350. In this graph, there is a visible divergence between the gray W T line and the blue Ttn Delta A164-167 line. While both start at 100 percent in the Z-disk, the blue line shows a slight dip to 85 percent around exons 50–75. Significant differences occur in the I-band region: between exons 130 and 160, the blue line drops sharply to near 0 percent several times, while the gray line maintains higher P S I values (averaging 40–80 percent). Between exons 170 and 210, the gray line shows a broad peak reaching 90 percent, whereas the blue line remains at 0 percent for that entire section. Both lines converge back to nearly 100 percent for the A-band and M-line starting around exon 220, though both show a sharp drop to 0 percent at exon 355. The image labeled E compares protein expression in the L V (Left Ventricle) and E D L (Extensor Digitorum Longus) muscles. In the Left Ventricle panel, the protein bands represent the cardiac isoforms of titin. Near the top of the gel, there are two distinct high-molecular-weight bands: N 2 B A (the upper, fainter band) and N 2 B (the lower, much darker and more prominent band). The band patterns for both the W T and the Ttn Delta A164-167 mutant appear virtually identical in intensity and position. Further down the gel, a mid-range band labeled T 2 (a titin degradation product) is visible, followed by a very thick, dark loading control band at the bottom labeled M H C. The E D L panel shows the protein profile for skeletal muscle, which differs noticeably from the cardiac panel. The top-most bands are labeled N 2 A and N 2 A-2. While the W T lane shows a clear, thick N 2 A band, the mutant Ttn Delta A164-167 lane shows an N 2 A band that appears slightly shifted or thinner, accompanied by changes in the lower bands. Below the primary N 2 A bands, there are several intermediate bands that are more numerous and distinct than those seen in the L V panel. The T 2 band is positioned similarly to the L V panel but appears slightly more defined. At the very bottom, the M H C band serves as a consistent loading reference, appearing as a thick, dark, horizontal block in both the W T and mutant lanes. The image labeled F is a bar graph representing the Optical Density (O D) Ratio for proteins in the Left Ventricle. The vertical axis ranges from 0.0 to 0.4 with increments of 0.1. Three pairs of bars compare W T (gray) and mutant (blue) for different protein ratios: N 2 B A/N 2 B, T T/M H C, and T 2/T T. Individual data points are plotted as dots over each bar, and error bars show the standard deviation. For all three protein ratios in the L V, the bars are of similar height, and each pair is marked with ns (not significant), indicating no statistical difference between the W T and mutant heart samples. The image labeled G shows the O D Ratio for the Extensor Digitorum Longus skeletal muscle. The vertical axis and increments are identical to Graph F (0.0 to 0.4). This graph compares two ratios: T T/ M H C and T 2/T T. For T T/M H C, the mutant (blue) bar is slightly higher than the W T (gray) bar, while for T 2/T T, the mutant bar is lower than the W T. However, both comparisons are labeled with n s, showing that these protein ratio changes in the skeletal muscle are not statistically significant. The image labeled H measures Grip Strength, plotted as Average Force per Body Weight (grams per gram). The vertical axis ranges from 0 to 6 with increments of 2. There are two bars: a W T bar (gray) and a Ttn Delta A164-167 bar (blue). The W T bar reaches an average value of approximately 4.0 grams per gram, while the mutant bar is significantly lower, reaching approximately 2.8 grams per gram. A bracket above the bars is marked with an asterisk, indicating a statistically significant decrease in grip strength for the mutant mice compared to the wild-type mice. All values are approximate.Genetically engineered mouse model lacking the first four domains of titin’s P-zone, A164–167. (A) Titin’s A-band is incorporated into the thick filament, with the P-zone linking the C-zone and M-band segments, spanning domains A164–170. Domains A164–167, which span 16 nm, were deleted in this mouse model. Ig domains: magenta; FnIII domains: white; titin kinase: purple; M-band M-is: blue. (B) Schematic of titin’s α and β conformations at the C-zone-to-P-zone transition region. (C) Titin exon usage in LV muscle from 3-mo-old TtnΔA164–167 mice (4 WT and 4 TtnΔA164–167 mice). (D) Titin exon usage in EDL muscle from 3-mo-old TtnΔA164–167 mice (4 WT and 4 TtnΔA164–167 mice). (E) Representative agarose protein gels of titin in LV and EDL muscles from WT (left lane in each pair) and TtnΔA164–167 mice (right lane in each pair). (F) For LV, the OD ratios of the N2BA to N2B titin isoforms (N2BA/N2B), total titin (TT, N2BA+N2B+T2) to MyHC, and T2 to total titin are plotted. (G) For EDL muscle, OD ratios of total titin to MHC (TT/MHC) and T2 to total titin (T2/TT) are plotted. Statistical significance was determined by an unpaired t test between WT and TtnΔA164–167 for each ratio. (H) Front-limb grip strength, measured in grams of force per grams of body weight, at 90 days of age. Each point is the average of three trials from one mouse; five WT and five TtnΔA164–167 mice were tested. ns, p ≥ 0.05; *p ≤ 0.05. Statistical significance was determined by an unpaired t test. OD, optical density. Source data are available for this figure: SourceData F1.
The C-terminal M-band segment of titin, on the other hand, contains Ig-like domains and seven unstructured “insertion sequences” named M-is1 through M-is7 (Bang et al., 2001). This segment of titin is essential for M-band structure and sarcomere formation (Musa et al., 2006; Peng et al., 2007; Radke et al., 2019) and interacts with other structural proteins like myomesin, obscurin, and obscurin-like 1, as well as signaling proteins such as muscle creatine kinase, four and a half LIM domains 2, and myospryn (Sarparanta et al., 2010; Hornemann et al., 2003; Weinert et al., 2006; Ackermann et al., 2009). Titin’s kinase domain (titin kinase) is implicated in titin mechanosensing and interacts with p62 and Nbr1 when ubiquitinated (Bogomolovas et al., 2014; Bogomolovas et al., 2021; Lange et al., 2005; Stahl et al., 2011; Puchner et al., 2008). The currently accepted model in the field for titin in the M-band indicates that titin molecules extend into the M-band to overlap with antiparallel titins by ∼120 nm (Obermann et al., 1996).
Linking titin’s C-zone and M-band segments is the proximal zone (P-zone). Titin’s P-zone segment, spanning only seven domains (A164–A170), is often overlooked or simply considered to be part of the M-band segment; however, its unique structural features and important interactions warrant examination. The domain pattern of this segment—Ig-Ig-FnIII-FnIII-Ig-Ig-FnIII—is unique from that of the D- and C-zones and lacks the M-is found in the M-band. While the A-band of titin contains many sets of 2–3 consecutive FnIII domains, there are no other pairs of Ig-like domains, except in the P-zone, which contains two tandem Ig-like pairs (Bang et al., 2001; Labeit et al., 1992). Furthermore, the linkers between the Ig domains in the A164–A165 and A168–A169 tandems are beta (β) strands, which are not present elsewhere in the tandem Ig segments of titin and are indicative of a need for rigidity, although this is untested (Steward et al., 2012). The C-terminal three domains of the P-zone, A168–A170, comprise a binding site for E3 ubiquitin ligases, including the MuRFs, and are thought to be important for protein degradation signaling (Mrosek et al., 2007; Müller et al., 2007; Lange et al., 2005; Bogomolovas et al., 2021).
Two groups recently revealed the structure of the native cardiac thick filament C-zone using cryo-electron tomography (Tamborrini et al., 2023) and cryo-electron microscopy (Dutta et al., 2023). Of particular interest was the finding that in the C-zone to P-zone transition region, titin adopts two conformations, termed titin alpha (α) and titin beta (β) (Tamborrini et al., 2023). Titin α extends to the M-band as was previously established. At domain A158, titin β bends to form a triangular loop (referred to as a “bowtie” in Tamborrini et al. [2023]) of 14 domains, through domain A167, including the first 4 P-zone domains (A164–167). Domains A168 through M1 were found to lie linearly along the filament alongside the P-zone myosin heads, but the titin domains beyond M1 were not detected in titin β. Since the β bowtie loop offsets domains A158-M1 from their normal locations in titin α, these domains exist in two locations in each half-thick filament in the model provided by Tamborrini et al., while domains beyond M1 exist in one location in the M-band of each half-thick filament (see Fig. 1 A for a schematic of this structure). This novel finding challenges the current paradigm for titin’s C-terminal structure and raises the question of what might be the functional purpose of the titin β loop and the domains that comprise it, particularly the P-zone domains.
It is unknown whether the first four P-zone domains, A164–A167, have binding partners outside of their interactions with myosin, and a role in thick filament structure and function has not been established. However, their high conservation across species suggests importance (Obermann et al., 1996; Labeit et al., 1992). Herein, we investigated the function of the first four domains of titin’s P-zone, A164–A167, using a novel mouse model in which they are removed, TtnΔA164–A167. Functional studies revealed mild cardiac diastolic functional changes and remodeling, along with transcriptional activation of stress and remodeling pathways. Extensor digitorum longus (EDL) muscle showed myosin fiber-type shifts and transcript-level changes in fast- and slow-associated genes, along with depressed contractile function. Structural studies in cardiac muscle indicate altered incorporation of titin and cardiac myosin binding protein-C (cMyBP-C) into the thick filament along with shorter A-bands. Taken together, the data indicate an important role of titin’s P-zone domains A164–167 in thick filament templating.
Materials and methods
Animal use
All procedures were performed according to the NIH Guide for the Care and Use of Laboratory Animals and approved by the Institutional Animal Care and University Committee of the University of Arizona. All animal experiments were performed at 3 mo of age.
Generation of the TtnΔA164–167 mouse model
The TtnΔA164–167 mouse model was generated by the Genetically Engineered Mouse Model Core (Arizona Core Network). CRISPR guide RNAs (gRNAs) for deleting the sequence encoding mouse titin domains A164–167 (the mouse titin gene P-zone domains A164–A167) were designed using the CRISPOR Design tool (https://crispor.gi.ucsc.edu/). Four guides were selected, and the successful ones were as follows: 5′-ACCCATGCAGAGAGAACTATAGG-3′ (5′gRNA1) and 5′-TGGAGCCTGAATCGGGACGTCGG-3′ (3′gRNA1) both on the reverse strand (PAM sequence in italic type). Synthego synthesized the chosen single guide RNAs (sgRNA). eSpCas9 recombinant protein was ordered from Millipore (ESPCAS9PRO-250UG). A single-stranded oligo (ssODN) with short homology arms for sequences on each side of the gRNA-mediated double-stranded break was designed and ordered from IDT (sequence: 5′-CAGACAGTTCACCATCGGCGGTTTGCTAGAAGCTACTGAATATGAGTTCCGAGTATTTGCTGAGAACGAGACTGGGCTCAGCCGACCACGTAGAACAGCTATGTCTGTCAAGACTAAACTAACACCGATTCAGGCTCCACACTTCAAGGAGGAGCTGAGAAACCTGAATGTAAGGTATCAGAGCAACGCCACTCTGGTCT-3′). Ribonucleoprotein complexes were assembled by incubating recombinant Cas9 protein with sgRNAs for 10 min at room temperature. Then, the ss oligo was added to the mixture, followed by 10 min of centrifugation at 10,000 rpm. The final concentrations used for the microinjections were 50/30/50 ng/μl, respectively. Fertilized eggs were collected from the oviducts of super-ovulated BL6/NJ females. Microinjection was performed by continuous-flow injection of the Cas9/gRNA/ssODN mixture into the pronucleus of 1-cell zygotes. Tail tipping of the newborn mice was utilized to purify DNA for genotyping by PCR, employing three screening primers: P1 5′-AGACAGTGCTTGGAAGAAGAGC-3′, P2 5′-GTTGGTGGCTCTGACTTGG-3′, and P3 5′-ATTGAAGGTCTTGAATATGAGTTCC-3′ producing a 351-bp band for the wild type (WT) and 415-bp band in the mice where the deletion occurred. Two positive founders were obtained, F8 and M12, and bred to WT Black 6/NJ mice to confirm transmission of the desired modification in F1 generation and establish stable colonies (see Fig. S1 A for details).
Panel A illustrates the CRISPR-Cas9 gene-editing strategy used to create the Delta A164-167 mutation. The top track represents the wild-type W T Ttn-203 genomic structure, which consists of a sequence of blue rectangular blocks representing exons labeled 342, 341, 340, 339, 338, and 337. Positioned above this sequence are two vertical arrows labeled 3’g R N A 1 (above exon 341) and 5’g R N A 1 (above exon 338), along with a small blue block labeled s s O D N near exon 341. Small colored triangular markers labeled with numbers 1, 3, and 2 are placed beneath exons 341 and 338. The bottom track shows the resulting mutant structure labeled Delta A164-167. In this mutant version, exons 340 and 339 are completely absent, and exon 341 is joined directly to exon 338. The sequence then continues with exons 337, 336, 335, and 334. Panel B: Genotype Distribution Pie Chart. This pie chart displays the genotype distribution of a total of 352 animals used in the study. The chart is divided into three sections represented by different colors and labels in a legend to the right. The first section is gray, representing the W T (Wild Type) group, which makes up 25.3 percent of the total. The second section is light blue, representing the Ttn Delta A164-167 H E T (Heterozygous) group, which accounts for the largest portion at 52.0 percent. The third section is medium blue, representing the homozygous Ttn Delta A164-167 group, which makes up 22.7 percent of the total population. Panel C: Growth Curves. This line graph illustrates the Growth curves of the mice over time. The vertical axis represents Body Mass (grams) and ranges from 0 to 40 with increments of 10. The horizontal axis represents Weeks of Age, ranging from 0 to over 10 weeks. The data is plotted for four distinct groups, shown in the legend to the right: Male W T, represented by a solid gray line. Male Ttn Delta A164-167: represented by a solid blue line. Female W T: represented by a dashed gray line. Female Ttn Delta A164-167: represented by a dashed blue line. All four lines start at approximately 5 grams at week 1 and show a steady upward trend as the animals age. The male groups (solid lines) consistently show a higher body mass than the female groups (dashed lines) starting around week 5. By week 12, the Male W T group reaches nearly 30 grams, while the Male mutant group is slightly lower at approximately 24 grams. Both female groups track closely together, ending at approximately 20 grams by week 12. Error bars representing standard deviation are visible for each data point on the lines. Panel D: Muscle Weight Normalized to Tibia Length. This grouped bar graph compares the muscle mass of six different skeletal muscles normalized to tibia length (M W/T L in milligrams per millimeter). The vertical axis ranges from 0 to 14 milligrams per milliliter with a break in the scale between 4 and 6. The horizontal axis lists the muscle types: T C (Tibialis Cranialis), E D L (Extensor Digitorum Longus), Quad (Quadriceps), Soleus, Plantaris, and Gast (Gastrocnemius). For each muscle, a gray bar represents the W T group and a blue bar represents the Ttn Delta A164-167 group. Each bar includes individual data points plotted as dots and error bars for standard deviation. The Quad muscle shows the highest values, approximately 11 milligrams per milliliter, while the Soleus shows the lowest, under 1 milligram per milliliter. Every comparison between the W T and mutant groups is topped with a bracket labeled ns, indicating that there are no statistically significant differences in muscle weight for any of the tissues tested. Panel E: Body Weight at 90 Days. This bar graph shows the total body weight of the mice at 90 days, normalized to tibia length (B W/T L in grams per millimeter). The vertical axis ranges from 0.0 to 2.0 grams per millimeter with increments of 0.5. A gray bar represents the W T group with an average value of approximately 1.5 grams per millimeter, and a blue bar represents the Ttn Delta A164-167 group with a nearly identical average. Both bars contain approximately ten individual data points and error bars. A bracket above the two bars is labeled ns, confirming that there is no statistically significant difference in normalized body weight between the wild-type and mutant mice at the 90-day mark. Panels F and G consist of two volcano plots showing differential gene expression in the Left Ventricle (L V) and Extensor Digitorum Longus (E D L). In both graphs, the vertical axis represents statistical significance as Log 10 P, while the horizontal axis represents the Log 2 fold change, indicating the magnitude of expression difference between Wild-Type and mutant samples. A legend to the right categorizes the data points: green dots for fast-associated genes, yellow for slow-associated genes, blue for genes with significant adjusted p-values, and red for genes that are significant in both adjusted p-value and Log-Fold Change (Log F C). Panel F (L V): The heart muscle exhibits a moderate number of significantly altered genes (red points). Key labeled genes include Hsd11b1 and Ace, which are significantly downregulated (negative Log F C), and Rny3 and Rny1, which are significantly upregulated (positive Log F C). The central cluster remains largely gray, suggesting that many core cardiac genes, such as Myh7 and Mybpc2, do not show major expression shifts. Panel G (E D L): The skeletal muscle shows a much higher density of significantly altered genes compared to the heart. There is a prominent upregulation of stress-response and structural genes, notably Ankrd1, Myl2, and Myom3. Conversely, genes like Tnnc2 are significantly downregulated. Interestingly, several slow-associated genes (yellow) and fast-associated genes (green) are scattered near the center, but the sheer volume of red points indicates a more profound transcriptomic remodeling in the EDL muscle than in the L V. All values are approximate.
Generation and characterization of the Ttn ΔA164–167 mouse model. (A) CRISPR tools used to generate the TtnΔA164–167 allele by CRISPR shown relative to the WT transcript Ttn-203 (ENSMUST00000099981.10); locations of gRNAs are indicated with arrows, and the repair template (ssOSD) alignment is shown relative to the gene structure—fusing the end of exon 338 (encoding Fn3 domain A163) in frame with the start of Ig A168 in exon 341. The screening primers P1 (black) and P2 (red) were used for genotyping in combination with the WT-specific P3 (blue) primer. This GEMM removed (GRCm39) chr2:76,544,965-76,547,093. This removed the sequence encoding titin domains A164–A167 (395 amino acids, 44 kDa). (B) Pie chart indicating the percentage of each genotype of offspring born to heterozygous parents in the TtnΔA164–167 strain and the percentage of the total for that genotype. GraphPad Prism χ-squared test indicates that the observed ratios do not significantly deviate from the expected F2 Mendelian ratio (1:2:1) of offspring (P = 0.8869). (C) Growth curves tracking body weight of each sex and genotype from 1 to 12 wk after birth. (D) Skeletal muscle weights normalized to tibia length for 8 male WT and 8 male TtnΔA164–167 mice. (E) Body weight normalized to tibia length at 90 days old for 8 male mice of each genotype. (F) Volcano plot of DEGs in TtnΔA164–167 and WT LV. (G) Volcano plot of DEGs in TtnΔA164–167 and WT EDL. To improve plot clarity, only genes with established roles in cardiac and/or skeletal muscle function or those discussed in the main text are labeled. GEMM, Genetically Engineered Mouse Model.
Panel A illustrates the CRISPR-Cas9 gene-editing strategy used to create the Delta A164-167 mutation. The top track represents the wild-type W T Ttn-203 genomic structure, which consists of a sequence of blue rectangular blocks representing exons labeled 342, 341, 340, 339, 338, and 337. Positioned above this sequence are two vertical arrows labeled 3’g R N A 1 (above exon 341) and 5’g R N A 1 (above exon 338), along with a small blue block labeled s s O D N near exon 341. Small colored triangular markers labeled with numbers 1, 3, and 2 are placed beneath exons 341 and 338. The bottom track shows the resulting mutant structure labeled Delta A164-167. In this mutant version, exons 340 and 339 are completely absent, and exon 341 is joined directly to exon 338. The sequence then continues with exons 337, 336, 335, and 334. Panel B: Genotype Distribution Pie Chart. This pie chart displays the genotype distribution of a total of 352 animals used in the study. The chart is divided into three sections represented by different colors and labels in a legend to the right. The first section is gray, representing the W T (Wild Type) group, which makes up 25.3 percent of the total. The second section is light blue, representing the Ttn Delta A164-167 H E T (Heterozygous) group, which accounts for the largest portion at 52.0 percent. The third section is medium blue, representing the homozygous Ttn Delta A164-167 group, which makes up 22.7 percent of the total population. Panel C: Growth Curves. This line graph illustrates the Growth curves of the mice over time. The vertical axis represents Body Mass (grams) and ranges from 0 to 40 with increments of 10. The horizontal axis represents Weeks of Age, ranging from 0 to over 10 weeks. The data is plotted for four distinct groups, shown in the legend to the right: Male W T, represented by a solid gray line. Male Ttn Delta A164-167: represented by a solid blue line. Female W T: represented by a dashed gray line. Female Ttn Delta A164-167: represented by a dashed blue line. All four lines start at approximately 5 grams at week 1 and show a steady upward trend as the animals age. The male groups (solid lines) consistently show a higher body mass than the female groups (dashed lines) starting around week 5. By week 12, the Male W T group reaches nearly 30 grams, while the Male mutant group is slightly lower at approximately 24 grams. Both female groups track closely together, ending at approximately 20 grams by week 12. Error bars representing standard deviation are visible for each data point on the lines. Panel D: Muscle Weight Normalized to Tibia Length. This grouped bar graph compares the muscle mass of six different skeletal muscles normalized to tibia length (M W/T L in milligrams per millimeter). The vertical axis ranges from 0 to 14 milligrams per milliliter with a break in the scale between 4 and 6. The horizontal axis lists the muscle types: T C (Tibialis Cranialis), E D L (Extensor Digitorum Longus), Quad (Quadriceps), Soleus, Plantaris, and Gast (Gastrocnemius). For each muscle, a gray bar represents the W T group and a blue bar represents the Ttn Delta A164-167 group. Each bar includes individual data points plotted as dots and error bars for standard deviation. The Quad muscle shows the highest values, approximately 11 milligrams per milliliter, while the Soleus shows the lowest, under 1 milligram per milliliter. Every comparison between the W T and mutant groups is topped with a bracket labeled ns, indicating that there are no statistically significant differences in muscle weight for any of the tissues tested. Panel E: Body Weight at 90 Days. This bar graph shows the total body weight of the mice at 90 days, normalized to tibia length (B W/T L in grams per millimeter). The vertical axis ranges from 0.0 to 2.0 grams per millimeter with increments of 0.5. A gray bar represents the W T group with an average value of approximately 1.5 grams per millimeter, and a blue bar represents the Ttn Delta A164-167 group with a nearly identical average. Both bars contain approximately ten individual data points and error bars. A bracket above the two bars is labeled ns, confirming that there is no statistically significant difference in normalized body weight between the wild-type and mutant mice at the 90-day mark. Panels F and G consist of two volcano plots showing differential gene expression in the Left Ventricle (L V) and Extensor Digitorum Longus (E D L). In both graphs, the vertical axis represents statistical significance as Log 10 P, while the horizontal axis represents the Log 2 fold change, indicating the magnitude of expression difference between Wild-Type and mutant samples. A legend to the right categorizes the data points: green dots for fast-associated genes, yellow for slow-associated genes, blue for genes with significant adjusted p-values, and red for genes that are significant in both adjusted p-value and Log-Fold Change (Log F C). Panel F (L V): The heart muscle exhibits a moderate number of significantly altered genes (red points). Key labeled genes include Hsd11b1 and Ace, which are significantly downregulated (negative Log F C), and Rny3 and Rny1, which are significantly upregulated (positive Log F C). The central cluster remains largely gray, suggesting that many core cardiac genes, such as Myh7 and Mybpc2, do not show major expression shifts. Panel G (E D L): The skeletal muscle shows a much higher density of significantly altered genes compared to the heart. There is a prominent upregulation of stress-response and structural genes, notably Ankrd1, Myl2, and Myom3. Conversely, genes like Tnnc2 are significantly downregulated. Interestingly, several slow-associated genes (yellow) and fast-associated genes (green) are scattered near the center, but the sheer volume of red points indicates a more profound transcriptomic remodeling in the EDL muscle than in the L V. All values are approximate.
Generation and characterization of the Ttn ΔA164–167 mouse model. (A) CRISPR tools used to generate the TtnΔA164–167 allele by CRISPR shown relative to the WT transcript Ttn-203 (ENSMUST00000099981.10); locations of gRNAs are indicated with arrows, and the repair template (ssOSD) alignment is shown relative to the gene structure—fusing the end of exon 338 (encoding Fn3 domain A163) in frame with the start of Ig A168 in exon 341. The screening primers P1 (black) and P2 (red) were used for genotyping in combination with the WT-specific P3 (blue) primer. This GEMM removed (GRCm39) chr2:76,544,965-76,547,093. This removed the sequence encoding titin domains A164–A167 (395 amino acids, 44 kDa). (B) Pie chart indicating the percentage of each genotype of offspring born to heterozygous parents in the TtnΔA164–167 strain and the percentage of the total for that genotype. GraphPad Prism χ-squared test indicates that the observed ratios do not significantly deviate from the expected F2 Mendelian ratio (1:2:1) of offspring (P = 0.8869). (C) Growth curves tracking body weight of each sex and genotype from 1 to 12 wk after birth. (D) Skeletal muscle weights normalized to tibia length for 8 male WT and 8 male TtnΔA164–167 mice. (E) Body weight normalized to tibia length at 90 days old for 8 male mice of each genotype. (F) Volcano plot of DEGs in TtnΔA164–167 and WT LV. (G) Volcano plot of DEGs in TtnΔA164–167 and WT EDL. To improve plot clarity, only genes with established roles in cardiac and/or skeletal muscle function or those discussed in the main text are labeled. GEMM, Genetically Engineered Mouse Model.
Body weight analysis and dissection
Body weight data from WT (11 males, 10 females) and TtnΔA164–167 (11 males, 4 females) mice were collected from 1 to 12 wk after birth. Dissection of muscles was performed on mice anesthetized with isoflurane (USP, Phoenix Pharmaceuticals, Inc.) and killed by cervical dislocation. The hearts were removed, and both atria, the right ventricle, and the left ventricle (LV) were rapidly dissected and weighed. The following skeletal muscles were dissected and rapidly weighed: tibialis cranialis, EDL, soleus, plantaris, gastrocnemius, and quadriceps. Both tibias were removed, and the mean tibia length was used for normalization of muscle weight data. All muscles were quick-frozen in liquid nitrogen and stored at −80°C.
Grip strength assay
3-mo-old male mice (5 WT, 5 TtnΔA164–167) were held by the tail and allowed to grip the pull bar of a Columbus Instruments grip strength meter (Chatillon Force Measurement DFEII, Columbus Instruments). With both front paws grasping the grip bar, the mice were gently pulled away at a constant speed, until they released the bar from their paws. The maximum force generated during the pull (in grams) was recorded, and this was repeated two times, for a total of three pulls per mouse. For each mouse, the average of the three pulls is reported, and normalized to body weight.
RNA sequencing
Mouse tissues from LV and EDL were collected from 3-mo-old mice (female for EDL and mixed male and female for LV) and stored in RNAlater (Thermo Fisher Scientific) to preserve RNA integrity. For RNA extraction, 600 μl prechilled buffer RLT (RNeasy Fibrous Tissue Mini Kit, Qiagen) with 1% β-mercaptoethanol was added to muscle tissue stored in RNAlater in a 4-ml cryovial. Tissue was disrupted by using a rotor–stator homogenizer for 30 s. A protein digest was performed by adding 600 μl RNase-free water containing 6 mAU Proteinase K and incubating at 55°C for 10 min. Samples were transferred to a 1.5-ml microfuge tube and centrifuged for 3 min at 14,000 g. The supernatant was pipetted to a 2-ml tube with 600 μl ethanol and transferred to an RNeasy mini spin column. Thereafter, RNA extraction was performed following the manufacturer’s instructions and quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). RNA integrity was checked by running the samples on 2100 Bioanalyzer (Agilent), and all RIN scores were confirmed to be ≥ 8. Directional libraries were prepared using NEBNext UltraExpress RNA Library Prep Kit after ribosomal RNA removal with NEBNext rRNA Depletion Kit v2.
Sequencing was performed on an Illumina NovaSeq X plus sequencer using 150-bp paired-end sequencing. Raw data are available under BioProject Accession ID PRJNA1412858. Adapters and low-quality reads were removed with fastp (Chen et al., 2018), and reads were mapped to the mouse genome (GRCm39/M36) using STAR (Dobin et al., 2013) with default settings.
Differential gene expression, gene ontology–term, and splicing analyses
DESeq2 (Love et al., 2014) was used to determine differentially expressed genes (DEGs) between WT and TtnΔA164–167 for EDL and LV tissues based on read counts determined with STAR. Heatmaps of genes associated with fast or slow fiber types were generated by selecting a subset of genes that are well known to be associated with type 1, 2A, or 2X fibers as determined by single-fiber proteomics (Murgia et al., 2021). Gene expression values were scaled by z-score normalization (z = (x − μ)/σ) to make gene expression differences more comparable regardless of the gene’s overall expression level or variability. Visualization was done using the pheatmap R package (Kolde R [2025]). pheatmap: Pretty Heatmaps. R package version 1.0.13, https://github.com/raivokolde/pheatmap).
Gene ontology (GO)–term analysis was performed using NIH’s functional annotation tool, DAVID (Sherman et al., 2022), using the top 300 DEGs (by adjusted P value).
For calculation of inclusion percentages from titin exons, inclusion reads (IRs) and exclusion reads (ERs) were counted for each exon based on titin transcript ENSMUST00000099981. IRs are reads overlapping the exon being investigated, normalized by exon length. ERs are reads either upstream or downstream that support exclusions of the read. From these factors, the following equations were used to calculate the PSI index using the ASpli R package (Mancini et al., 2021): ,where i is the exon number and n the normalized read counts. The PSIi of exoni could then be calculated based on normalized counts as follows: .
Titin exon numbering in splice graphs is based on equivalent human exons from isoform ENST00000589042.
Quantification of protein expression
Protein expression was quantified as previously described (Karimi et al., 2024; Li et al., 2020). Flash-frozen LV and EDL tissues from 8 WT to 8 TtnΔA164–167 3-mo-old male mice were pulverized in liquid nitrogen and then solubilized in urea buffer ([in mol/L]: 8 urea, 2 thiourea, 0.05 Tris-HCl, 0.075 dithiothreitol [DTT] with 3% SDS, and 0.03% bromophenol blue, pH 6.8) and 50% glycerol with protease inhibitors ([in mmol/L]: 0.04 E64, 0.16 leupeptin, and 0.2 phenylmethylsulfonyl fluoride [PMSF]) at 60°C for 10 min. Samples were centrifuged at 13,000 RPM for 5 min, aliquoted, flash-frozen in liquid nitrogen, and stored at −80°C. Titin isoform analysis was performed on solubilized samples (from n = 8 male; n = 8 male TtnΔA164–167 90- to 100-day-old mice) using a vertical SDS-agarose gel system as previously described (Warren et al., 2003). Then, 1% gels were run at 15 mA per gel for 3:20, then stained using Coomassie brilliant blue, scanned using a commercial scanner, and analyzed with One-D scan (Scanalytics Inc.). The integrated optical density (IOD) of titin and myosin heavy chain (MHC) was determined as a function of loading volume (in a range of 5 volumes). The slope of the linear relationship between IOD and loading was obtained for each protein to quantify expression ratios.
For western blotting, solubilized samples were run on a 12% agarose gel, then transferred onto polyvinylidene difluoride membranes using a semi-dry transfer unit (Trans-Blot Cell, Bio-Rad). Blots were stained with Ponceau S to visualize the total protein transferred. Blots were then probed with primary antibodies followed by secondary antibodies conjugated with infrared fluorescent dyes. Blots were scanned using Odyssey Infrared Imaging System (Li-COR Biosciences). Primary antibodies included anti-ANT1/2 (Proteintech) and anti-GAPDH (Santa Cruz, Cell Signaling). Secondary antibodies used were CF790 goat anti-mouse and CF680 goat anti-rabbit (Biotium).
For MHC protein quantification, EDL and soleus samples from the n = 5–6 WT and n = 5–6 TtnΔA164–167 3-mo-old mice used for whole-muscle mechanics (below), as well as n = 8 WT and n = 8 TtnΔA164–167 LV samples, were solubilized as above. MHC isoform analysis was performed as previously described (Li et al., 2015). Briefly, MHC isoforms were separated using 8% (7% for LV samples) acrylamide gels, run for 24 h at 15°C and a constant voltage of 275 V, and stained with Coomassie blue. Gels were scanned and analyzed with ImageJ (v1.49, NIH, Bethesda, MD, USA). MHC type I and IIB are well separated on gels, but the IIA overlaps with IIX due to insufficient separation on most gels. We refer to this band as IIA/IIX. The identity of the bands was established by running standard lysates consisting of a mixture of EDL and soleus muscle lysates, containing all isoforms in a well-established order (i.e., IIA/X at top, IIB in middle, and I at bottom, e.g., see Fig. 2 D). For LV samples, a standard lysate known to contain both α-myosin and β-myosin was used.
Panel A: Gene Ontology (G O) Enrichment Analysis: The horizontal bar graph illustrates the Fold Enrichment of various biological categories significantly altered in the study. The horizontal axis represents the Fold Enrichment value, ranging from 0 to 30 with increments of 10. The vertical axis lists several Gene Ontology terms categorized by color: pink for Cellular Component (C C), bright orange for Biological Process (B P), and light orange for Molecular Function (M F). In the CC category, the Mitochondrial outer membrane and Mitochondrial matrix show the highest enrichment at approximately 8. Within the B P category, Canonical glycolysis shows the most significant enrichment, reaching nearly 30, followed by Glycolytic process at approximately 18. In the M F category, the Extracellular matrix structural constituent shows the highest enrichment at 10. Panel B: L V My H C Isoform Analysis: This panel displays the analysis of Myosin Heavy Chain (My H C) isoforms in the Left Ventricle (L V). At the top, a protein gel blot compares W T and Ttn Delta A164-167 samples. Two distinct bands are visible in the left-most lane: an upper band labeled alpha-myosin and a lower band labeled beta-myosin. In the subsequent W T and mutant lanes, only the upper alpha-myosin band is prominent. Below the blot, a bar graph quantifies these results as a percentage. The vertical axis ranges from 0 to 100. For both the W T and the Ttn Delta A164-167 groups, the bars reach 100 percent and are colored entirely with a red outline, indicating that nearly 100 percent of the myosin present in the L V for both genotypes consists of the alpha isoform. Panel C: Heatmap of Differential Gene Expression: This heatmap visualizes the relative expression levels of various muscle-related genes in Ttn Delta A164-167 and W T samples. The vertical axis lists gene symbols. The horizontal axis separates the samples into two main groups: the mutant strain on the left and the W T strain on the right. A color scale to the right indicates the expression level, where red (up to 2) represents higher expression, yellow (0) represents baseline, and blue (down to minus 2) represents lower expression. The map shows two distinct clusters: the top group of genes is significantly upregulated in the mutant mice (appearing orange/red) compared to W T (appearing light blue), while the bottom group of genes is significantly downregulated in the mutant mice (appearing blue/green) compared to the W T (appearing orange/red). This pattern indicates a major transcriptomic shift in the mutant skeletal muscle. Panel D: E D L My H C Isoform Analysis. This panel provides a protein-level analysis of Myosin Heavy Chain (My H C) isoforms in the Extensor Digitorum Longus (E D L) muscle. At the top, a protein gel blot shows separated bands corresponding to different fiber types: I I A/X (top), I I B (middle), and I (bottom). Below the blot, a stacked bar graph quantifies these isoforms as a percentage, with the vertical axis ranging from 0 to 100. For both the W T and mutant groups, the bars are divided into two sections. In the W T group, the I I A plus I I X isoforms make up roughly 10 percent of the total, while the IIB isoform dominates at approximately 90 percent. In the Ttn Delta A164-167 group, the I I A plus I I X section significantly increases to approximately 25 percent, and the I I B section decreases to roughly 75 percent. These significant changes are marked with four asterisks. All values are approximate.RNA sequencing and fiber typing results. (A) GO terms associated with the DEGs in LV tissue for CC (pink), BP (orange), and MF (peach) categories. Significantly enriched GO terms were determined by Fisher’s exact test. 4 WT and 4 TtnΔA164–167 mice were used for RNA-seq experiments. (B) MyHC ratios in LV muscle were determined by SDS-PAGE. LV lysate from 8 WT to 8 TtnΔA164–167 mice was used. Only α-myosin was detected. (C) Heatmap demonstrating the upregulation of slow fiber type–associated genes and downregulation of fast fiber type–associated genes in TtnΔA164–167 EDLs. 4 WT and TtnΔA164–167 mice were used for RNA-seq experiments. (D) MyHC ratios in EDL muscle were determined by SDS-PAGE. Statistical significance was determined by multiple t tests (WT vs. TtnΔA164–167 by fiber type). 5–6 mice of each genotype were used. CC, cellular component; BP, biological processes; MF, molecular function. ****p ≤ 0.0001. Source data are available for this figure: SourceData F2.
Panel A: Gene Ontology (G O) Enrichment Analysis: The horizontal bar graph illustrates the Fold Enrichment of various biological categories significantly altered in the study. The horizontal axis represents the Fold Enrichment value, ranging from 0 to 30 with increments of 10. The vertical axis lists several Gene Ontology terms categorized by color: pink for Cellular Component (C C), bright orange for Biological Process (B P), and light orange for Molecular Function (M F). In the CC category, the Mitochondrial outer membrane and Mitochondrial matrix show the highest enrichment at approximately 8. Within the B P category, Canonical glycolysis shows the most significant enrichment, reaching nearly 30, followed by Glycolytic process at approximately 18. In the M F category, the Extracellular matrix structural constituent shows the highest enrichment at 10. Panel B: L V My H C Isoform Analysis: This panel displays the analysis of Myosin Heavy Chain (My H C) isoforms in the Left Ventricle (L V). At the top, a protein gel blot compares W T and Ttn Delta A164-167 samples. Two distinct bands are visible in the left-most lane: an upper band labeled alpha-myosin and a lower band labeled beta-myosin. In the subsequent W T and mutant lanes, only the upper alpha-myosin band is prominent. Below the blot, a bar graph quantifies these results as a percentage. The vertical axis ranges from 0 to 100. For both the W T and the Ttn Delta A164-167 groups, the bars reach 100 percent and are colored entirely with a red outline, indicating that nearly 100 percent of the myosin present in the L V for both genotypes consists of the alpha isoform. Panel C: Heatmap of Differential Gene Expression: This heatmap visualizes the relative expression levels of various muscle-related genes in Ttn Delta A164-167 and W T samples. The vertical axis lists gene symbols. The horizontal axis separates the samples into two main groups: the mutant strain on the left and the W T strain on the right. A color scale to the right indicates the expression level, where red (up to 2) represents higher expression, yellow (0) represents baseline, and blue (down to minus 2) represents lower expression. The map shows two distinct clusters: the top group of genes is significantly upregulated in the mutant mice (appearing orange/red) compared to W T (appearing light blue), while the bottom group of genes is significantly downregulated in the mutant mice (appearing blue/green) compared to the W T (appearing orange/red). This pattern indicates a major transcriptomic shift in the mutant skeletal muscle. Panel D: E D L My H C Isoform Analysis. This panel provides a protein-level analysis of Myosin Heavy Chain (My H C) isoforms in the Extensor Digitorum Longus (E D L) muscle. At the top, a protein gel blot shows separated bands corresponding to different fiber types: I I A/X (top), I I B (middle), and I (bottom). Below the blot, a stacked bar graph quantifies these isoforms as a percentage, with the vertical axis ranging from 0 to 100. For both the W T and mutant groups, the bars are divided into two sections. In the W T group, the I I A plus I I X isoforms make up roughly 10 percent of the total, while the IIB isoform dominates at approximately 90 percent. In the Ttn Delta A164-167 group, the I I A plus I I X section significantly increases to approximately 25 percent, and the I I B section decreases to roughly 75 percent. These significant changes are marked with four asterisks. All values are approximate.RNA sequencing and fiber typing results. (A) GO terms associated with the DEGs in LV tissue for CC (pink), BP (orange), and MF (peach) categories. Significantly enriched GO terms were determined by Fisher’s exact test. 4 WT and 4 TtnΔA164–167 mice were used for RNA-seq experiments. (B) MyHC ratios in LV muscle were determined by SDS-PAGE. LV lysate from 8 WT to 8 TtnΔA164–167 mice was used. Only α-myosin was detected. (C) Heatmap demonstrating the upregulation of slow fiber type–associated genes and downregulation of fast fiber type–associated genes in TtnΔA164–167 EDLs. 4 WT and TtnΔA164–167 mice were used for RNA-seq experiments. (D) MyHC ratios in EDL muscle were determined by SDS-PAGE. Statistical significance was determined by multiple t tests (WT vs. TtnΔA164–167 by fiber type). 5–6 mice of each genotype were used. CC, cellular component; BP, biological processes; MF, molecular function. ****p ≤ 0.0001. Source data are available for this figure: SourceData F2.
Recombinant protein expression and purification
Plasmid generation
The mouse titin A164–167 sequence (UniProt entry A2ASS6, amino acid positions 32322–32710) was codon-optimized for Escherichia coli expression by GenScript. The ALFA tag sequence (5′-SRLEEELRRRLTE-3′) (Götzke et al., 2019) was also codon-optimized, and both sequences were cloned into the pET-52b(+) expression plasmid between the BamHI and SacI restriction enzyme sites (see Fig. S2 A for plasmid map).
Panel A: The plasmid vector map represents the genetic construct p E T 52 b: m A164-167 A L F A 10xHis, which has a total size of 6421 base pairs (bp). The circular map identifies various functional components labeled with arrows and text boxes, including the lacI gene (purple arrow), a lac operator, and a lacI promoter positioned upstream of the main expression cassette. The cassette itself contains a T 7 promoter and a ribosome binding site (R B S) followed by the specific titin immunoglobulin domains A164 (red), A165 (red), A166 (white), and A167 (white). For protein purification and detection, the map shows several tag sequences, including a Strep-Tag 2, an H R V 3 C site, an A L F A-tag, a thrombin site, and a 10xHis tag, terminating at a T 7 terminator. The backbone includes additional regulatory and selection elements. Panel B: Protein Pull-Down Assay shows a Coomassie-stained S D S-P A G E gel used to analyze the interaction between recombinant titin domains and muscle lysates. The left-most lane contains a molecular weight marker with labels ranging from 25 to 250 kilodaltons. The subsequent lanes show various combinations of the recombinant protein rA164-167-A L F A, Gastrocnemius (Gast) lysate, and Left Ventricle (L V) lysate. A very thick, prominent band is visible at approximately 55 kilodaltons in all lanes where the recombinant protein was added, corresponding to its predicted molecular weight. Panel C: Protein Identity Table lists the candidate protein interaction partners identified from the pull-down assay based on their molecular weights. The first column, Molecular Weight, lists three categories: 250 kilodaltons, 100 kilodaltons, and 30 kilodaltons. The second column, Protein Identity, correlates these weights to specific proteins: Myosin-4 and Myosin-1 at 250 kilodaltons; S E R C A 1 and S E R C A 2 at 100 kilodaltons; and A N T 1 and A N T 2 at 30 kilodaltons. Panel D: L V A N T 1, 2 Expression. This panel quantifies the protein expression level of A N T 1/2 in the Left Ventricle (L V). The vertical axis represents the ratio of A N T 1/2/G A P D H, ranging from 0.000 to 0.020 with increments of 0.005. The W T group (gray bar) has a mean value of approximately 0.011, while the Ttn Delta A164-167 group (blue bar) is slightly higher with a mean of approximately 0.013. Below the bar graph, a western blot shows the bands for G A P D H (top) and A N T 1/2 (bottom) for both genotypes. A bracket labeled ns indicates that the difference in A N T 1/2 expression in cardiac tissue is not statistically significant. Panel E: E D L A N T 1/2 Expression. This panel quantifies the expression of A N T 1, 2 in the Extensor Digitorum Longus (E D L) muscle. The vertical axis represents the A N T 1/2/G A P D H ratio, ranging from 0.0 to 1.0 with increments of 0.2. The W T group (gray bar) averages roughly 0.44, and the Ttn Delta A164-167 group (blue bar) averages roughly 0.54. Similar to the cardiac data, the western blot bands for G A P D H and A N T 1/2 are shown below the graph. The bracket labeled ns confirms that there is also no statistically significant difference in the expression of these proteins in skeletal muscle between the two groups. All values are approximate.Pulldown assays to probe for potential binding partners of the titin A164–167 segment. (A) Map of the plasmid used to produce the recombinant titin A164–167 bait protein. (B) Representative gel image from a pulldown assay in which the recombinant ALFA-tagged A164–167 protein (rA164–167-ALFA) was used to probe gastrocnemius (gast) or LV tissue lysates. The boxed areas were cut from the gel and analyzed by LC-MS/MS to identify the main protein components. (C) Table of the bands tested by mass spectrometry and the top protein hits. (D) Western blot quantification of ANT1/2 levels normalized to GAPDH in LV tissue lysate. (E) Western blot quantification of ANT1/2 levels normalized to GAPDH in EDL tissue lysate. Statistical significance for D and E was determined by an unpaired t test. Tissue lysates from 8 WT and 8 TtnΔA164–167 were used. Source data are available for this figure: SourceData FS2.
Panel A: The plasmid vector map represents the genetic construct p E T 52 b: m A164-167 A L F A 10xHis, which has a total size of 6421 base pairs (bp). The circular map identifies various functional components labeled with arrows and text boxes, including the lacI gene (purple arrow), a lac operator, and a lacI promoter positioned upstream of the main expression cassette. The cassette itself contains a T 7 promoter and a ribosome binding site (R B S) followed by the specific titin immunoglobulin domains A164 (red), A165 (red), A166 (white), and A167 (white). For protein purification and detection, the map shows several tag sequences, including a Strep-Tag 2, an H R V 3 C site, an A L F A-tag, a thrombin site, and a 10xHis tag, terminating at a T 7 terminator. The backbone includes additional regulatory and selection elements. Panel B: Protein Pull-Down Assay shows a Coomassie-stained S D S-P A G E gel used to analyze the interaction between recombinant titin domains and muscle lysates. The left-most lane contains a molecular weight marker with labels ranging from 25 to 250 kilodaltons. The subsequent lanes show various combinations of the recombinant protein rA164-167-A L F A, Gastrocnemius (Gast) lysate, and Left Ventricle (L V) lysate. A very thick, prominent band is visible at approximately 55 kilodaltons in all lanes where the recombinant protein was added, corresponding to its predicted molecular weight. Panel C: Protein Identity Table lists the candidate protein interaction partners identified from the pull-down assay based on their molecular weights. The first column, Molecular Weight, lists three categories: 250 kilodaltons, 100 kilodaltons, and 30 kilodaltons. The second column, Protein Identity, correlates these weights to specific proteins: Myosin-4 and Myosin-1 at 250 kilodaltons; S E R C A 1 and S E R C A 2 at 100 kilodaltons; and A N T 1 and A N T 2 at 30 kilodaltons. Panel D: L V A N T 1, 2 Expression. This panel quantifies the protein expression level of A N T 1/2 in the Left Ventricle (L V). The vertical axis represents the ratio of A N T 1/2/G A P D H, ranging from 0.000 to 0.020 with increments of 0.005. The W T group (gray bar) has a mean value of approximately 0.011, while the Ttn Delta A164-167 group (blue bar) is slightly higher with a mean of approximately 0.013. Below the bar graph, a western blot shows the bands for G A P D H (top) and A N T 1/2 (bottom) for both genotypes. A bracket labeled ns indicates that the difference in A N T 1/2 expression in cardiac tissue is not statistically significant. Panel E: E D L A N T 1/2 Expression. This panel quantifies the expression of A N T 1, 2 in the Extensor Digitorum Longus (E D L) muscle. The vertical axis represents the A N T 1/2/G A P D H ratio, ranging from 0.0 to 1.0 with increments of 0.2. The W T group (gray bar) averages roughly 0.44, and the Ttn Delta A164-167 group (blue bar) averages roughly 0.54. Similar to the cardiac data, the western blot bands for G A P D H and A N T 1/2 are shown below the graph. The bracket labeled ns confirms that there is also no statistically significant difference in the expression of these proteins in skeletal muscle between the two groups. All values are approximate.Pulldown assays to probe for potential binding partners of the titin A164–167 segment. (A) Map of the plasmid used to produce the recombinant titin A164–167 bait protein. (B) Representative gel image from a pulldown assay in which the recombinant ALFA-tagged A164–167 protein (rA164–167-ALFA) was used to probe gastrocnemius (gast) or LV tissue lysates. The boxed areas were cut from the gel and analyzed by LC-MS/MS to identify the main protein components. (C) Table of the bands tested by mass spectrometry and the top protein hits. (D) Western blot quantification of ANT1/2 levels normalized to GAPDH in LV tissue lysate. (E) Western blot quantification of ANT1/2 levels normalized to GAPDH in EDL tissue lysate. Statistical significance for D and E was determined by an unpaired t test. Tissue lysates from 8 WT and 8 TtnΔA164–167 were used. Source data are available for this figure: SourceData FS2.
Protein expression and purification
NiCO21 cells were transformed with the pET52b(+) plasmid encoding the titin A164–A167 segment. Clones were grown in 300 ml of LB broth supplemented with 0.1 mg/ml carbenicillin overnight at 30°C. The next day, the bacteria were pelleted by centrifugation and resuspended in 300 ml fresh LB broth supplemented with 0.1 mg/ml carbenicillin and 1 mM isopropyl β-D-thiogalactoside to induce protein expression overnight at 16°C. Cells were pelleted, followed by lysis and extraction using an EmulsiFlex-C3 (Avestin, Inc.). Cell extracts were purified using Ni-NTA resin (Qiagen). The purified protein was dialyzed into a HEPES-based storage buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 10% glycerol, 2 mM DTT).
Pulldown/mass spectrometry experiments
ALFA Selector ST pulldowns
Pulldowns from muscle tissue lysates were performed using the ALFA Selector ST system (Götzke et al., 2019). Tissue lysates were prepared by adding fresh tissue (gastrocnemius or LV) to 20 volumes of cold lysis buffer (50 mM HEPES, 150 mM NaCl, 20 mM NaPO4, 20 mM β-glycerophosphate, 10 mM NaF, 2 mM EDTA, 1% IGEPAL CA-630, 10% glycerol, 1 mM MgCl2, 1 mM CaCl2, 2.5 mM PMSF, 2 mM Na3VO4, 20 μg/ml leupeptin, 10 μM E-64) and homogenizing using a Tissue Tearor handheld homogenizer (Cole-Parmer) in 10-s pulses. The homogenate was incubated on ice for 30–60 min, followed by clarifying by centrifuge at 25,000 × g.
Pulldowns were performed in mini spin columns (Enzymax LLC). The sdAb anti-ALFA ST resin (NanoTag Biotechnologies) was vortexed to suspend evenly, and 20 μl of resin slurry was transferred to each mini spin column. Resin was washed three times with lysis buffer by centrifuging for 1 min at 1,000 × g. ALFA-tagged recombinant protein (30 μg) (titin fragment A164–167) and an excess of tissue lysate were added to the mini spin columns. Control columns contained lysate-only or recombinant protein-only. The columns were incubated overnight at 4°C with gentle agitation. Mini spin columns were then centrifuged for 1 min at 1,000 × g to remove unbound contents and washed five times with wash buffer (0.01 M phosphate-buffered saline [PBS], 20 mM β-glycerophosphate, 10 mM NaF, 2 mM EDTA, 2.5 mM PMSF, 2 mM Na3VO4, 20 μg/ml leupeptin, 10 μM E-64, 0.5% IGEPAL CA-630). A final wash was performed with 0.01 M PBS. Two denaturation/elution steps were performed. First, 10 μl SDS-PAGE buffer (4% SDS, 0.0625 M Tris-HCl, 10% glycerol, 0.2% bromophenol blue, 8 M urea, 5% β-mercaptoethanol) was added to each mini spin column, columns were incubated in a 95°C water both for 4 min, and elution into a fresh 2-ml tube (Eppendorf) was performed by centrifugation for 1 min at 1,000 × g. The second elution step was performed as above using 20 μl SDS–urea buffer and by centrifuging for 30 s at 10,000 × g.
An entire eluate was loaded onto a Criterion 4–20% TGX Precast Midi Protein Gel (#5671095; Bio-Rad) and resolved by SDS-PAGE. Gels were stained with Coomassie brilliant blue (2% H3PO4, 10% (NH4)2SO4, 0.1% CBB-G250) and destained with 25% methanol. Gel bands of interest were sliced from the gels and processed as below.
In-gel digestion
The gel slices were subjected to trypsin digestion, and the resulting peptides were purified by C18-based desalting exactly as previously described (Kruse et al., 2017; Parker et al., 2019). In brief, the SDS-PAGE gel slices were placed in a 0.6-ml LoBind polypropylene tube (Eppendorf), destained twice with 375 μl of 50% acetonitrile (ACN) in 40 mM NH4HCO3, and dehydrated with 100% ACN for 15 min. After removal of the ACN by aspiration, the gel pieces were dried in a vacuum centrifuge at 60°C for 30 min. Trypsin (250 ng; Sigma-Aldrich) in 20 μl of 40 mM NH4HCO3 was added, and the samples were maintained at 4°C for 15 min prior to the addition of 50–100 μl of 40 mM NH4HCO3. The digestion was allowed to proceed at 37°C overnight and was terminated by the addition of 10 μl of 5% formic acid (FA). After further incubation at 37°C for 30 min and centrifugation for 1 min, each supernatant was transferred to a clean LoBind polypropylene tube. The extraction procedure was repeated using 40 μl of 0.5% FA, and the two extracts were combined and dried down to ∼5–10 μl followed by the addition of 10 μl of 0.05% heptafluorobutyric acid/5% FA (vol/vol) and incubation at room temperature for 15 min. The resulting peptide mixtures were loaded on a solid-phase C18 ZipTip (Millipore) and washed with 35 μl 0.005% heptafluorobutyric acid/5% FA (vol/vol) followed by elution first with 4 μl of 50% ACN/1% FA (vol/vol) and then a more stringent elution with 4 μl of 80% ACN/1% FA (vol/vol). The eluates were combined and dried completely by vacuum centrifugation, and 6 μl of 0.1% FA (vol/vol) was added followed by sonication for 2 min. 2.5 μl of the final sample was then analyzed by mass spectrometry.
Mass spectrometry and database search
HPLC-ESI-MS/MS was performed in positive ion mode on a Thermo Fisher Scientific Orbitrap Fusion Lumos Tribrid mass spectrometer fitted with an EASY-Spray source (Thermo Fisher Scientific) as previously described (Parker et al., 2019). In brief, NanoLC was performed using a Thermo Fisher Scientific UltiMate 3000 RSLCnano System with an EASY-Spray C18 LC column (cat. # ES803; Thermo Fisher Scientific, 50 cm × 75 mm inner diameter, packed with PepMap RSLC C18 material, 2 mm); loading phase for 15 min; mobile phase, linear gradient of 1–47% ACN in 0.1% FA for 106 min, followed by a step to 95% ACN in 0.1% FA over 5 min, hold for 10 min, and then a step to 1% ACN in 0.1% FA over 1 min and a final hold for 19 min (total run 156 min); Buffer A = 100% H2O in 0.1% FA; Buffer B = 80% ACN in 0.1% FA; and flow rate, 300 nl/min. All solvents were of liquid chromatography–mass spectrometry grade. Spectra were acquired using Xcalibur, version 2.3 (Thermo Fisher Scientific). A “TopSpeed” data-dependent MS/MS analysis was performed (acquisition of a full scan spectrum followed by collision-induced dissociation mass spectra of the Top N most intense precursor ions within the 3-s cycle time). Dynamic exclusion was enabled with a repeat count of 1, a repeat duration of 30 s, an exclusion list size of 500, and an exclusion duration of 40 s. Tandem mass spectra were extracted from Xcalibur “RAW” files, and charge states were assigned using the ProteoWizard 3.0 msConvert script using the default parameters. The fragment mass spectra were searched against the Swiss-Prot Mus musculus database (17,097 entries) using Mascot (Matrix Science; version 2.4) using the default probability cutoff score. The search variables that were used were as follows: 10 ppm mass tolerance for precursor ion masses and 0.5 Da for product ion masses; digestion with trypsin; a maximum of two missed tryptic cleavages; variable modifications of oxidation of methionine and phosphorylation of serine, threonine, and tyrosine. Cross-correlation of Mascot search results with X! Tandem was accomplished with Scaffold (Proteome Software). Probability assessment of peptide assignments and protein identifications was made using Scaffold. Only peptides with ≥95% probability were considered.
Single EDL fiber mechanics
Dissection
The EDL muscles were excised from both hindlimbs (3–8 fibers from each of 3 WT and 3 TtnΔA164–167 male and female mice) and demembranated overnight in skinning solution at 4°C (see the Solutions section). On the following day, the EDL muscles were thoroughly washed with relaxing solution (see the Solutions section) and stored at 4°C in fresh relaxing solution, which was refreshed every 24 h, for up to 3 days for experiments.
For experiment, the EDL muscles were transferred to fresh relaxing solution, single muscle fibers were carefully isolated, and both ends of each fiber were attached to T-clips allowing mounting onto a force transducer (403A; Aurora Scientific) and a high-speed length controller (802D-120-322-TJ; Aurora Scientific). Sarcomere length was simultaneously measured using a high-speed VSL camera integrated with ASI 900B software (Aurora Scientific). The fiber cross-sectional area (CSA) was determined at a sarcomere length of 2.4 µm by measuring width and height (via a right-angle prism) at three different locations along its length. The measurements were then averaged, and CSA was calculated by approximating the cross-section as an ellipse. Mechanical experiments were performed at 15°C.
Passive force measurements
Passive force, including peak, elastic, and viscous components, was measured at sarcomere lengths between 2.4 and 3.6 µm, as previously described (Han et al., 2025). Initially, the fiber was positioned at slack length to establish zero force and then adjusted to 2.4 µm to determine the CSA. The fiber was subjected to a passive stretch of 5% at a stretching velocity of 1%/s, followed by a 20-s hold. This stretch protocol was repeated 10 times, with sarcomere length progressively increased up to 3.6 µm before being positioned back to 2.4 µm.
Active force measurements
Active force, cross-bridge kinetics, and calcium sensitivity were evaluated as previously described (Han et al., 2025). Following a 5-min rest at slack length, the fiber was stretched to a sarcomere length of 2.6 µm and activated (see the Solutions section). Activation was maintained until maximum steady-state force was reached for >5 s. Deactivation was then induced using relaxing solution. The obtained active forces were normalized to the fiber’s CSA measured at 2.6 µm to calculate stress (expressed in mN/mm2).
To prevent the possibility of slippage of the fibers from the rig during activation, micro-knots were tied at both ends of each fiber using 7-0 silk suture, and the knots were secured within T-clips. The T-clips were mounted onto the rig by hooks through the hole in each T-clip. To prevent the T-clip from moving during activation, a small amount of high-vacuum grease was applied to the hook tip, which fixes the T-clips to the rig.
Cross-bridge kinetics
Cross-bridge kinetics were quantified by measuring the rate of tension redevelopment (Ktr) (Han et al., 2025). Briefly, the muscle fiber was first set at 2.4 µm and activated to achieve maximum steady-state active force. Once the active force reached its steady state, the fiber was rapidly shortened by 20%, held at the shortened sarcomere length for 0.02 s, and then quickly returned to its initial sarcomere length of 2.4 µm. Ktr was determined by fitting a single-exponential function to the force redevelopment curve.
Calcium sensitivity
Calcium sensitivity of skeletal muscle fibers was examined by measuring active force at various calcium concentrations (expressed in pCa, −log[Ca2+]), ranging from 4.5, 5.7, 5.9, 6.0, 6.25, to 9.0 pCa, with one force–pCa curve per fiber (Han et al., 2025). Each fiber was first set at a slack sarcomere length to establish zero force and stretched to a sarcomere length of either 2.6 µm or 3.0 µm. The measurements began in pCa 9.0 solution, and the fiber was sequentially transferred to solutions of increasing calcium concentration once the steady-state active force was obtained. The active force was first converted to stress by using the CSA of the fibers and normalized to its maximum stress achieved at pCa 4.5. Stress–pCa data were then fit with a Hill equation to determine both the EC50 (level of [Ca2+] where 50% of maximum active force was achieved) and the Hill coefficient.
Solutions
Relaxing solution contains 40 mM BES, 10 mM EGTA, 6.56 mM MgCl2, 5.88 mM Na-ATP, 46.35 mM potassium propionate, 15 mM creatine phosphate, 1 mM DTT, and protease inhibitors including 1 mM E64, 1 mM leupeptin, and 1.25 mM PMSF (Ogut et al., 1999). Activating solution contains 40 mM BES, 10 mM CaCO3-EGTA, 6.29 mM MgCl2, 6.12 mM Na-ATP, 45.3 mM potassium propionate, 15 mM creatine phosphate, 1 mM DTT, and protease inhibitors (same as in the relaxing solution). For skinning solution, 1% Triton X-100 was mixed into the relaxing solution. Submaximal activating solutions, ranging from 5.7 to 6.25 pCa for calcium sensitivity measurements, were obtained by mixing relaxing and activating solutions based on Fabiato Program, set at 15°C (Ogut et al., 1999). All solutions were set at pH 7.0.
Cardiomyocyte mechanics
Solutions
The compositions of all solutions have been reported previously (Pappas et al., 2018). Activating solution and relaxing solution were mixed to obtain activating solutions containing between 0.64 and 46.8 μM [Ca2+] (pCa 6.2–4.3). Experiments were performed at 15°C.
Stress–calcium relationship
Single-cell experiments were performed on an inverted microscope stage using an Aurora Scientific 803B permeabilized myocyte apparatus with a 406A force transducer. Permeabilized single cells were obtained by first thawing a piece of frozen LV wall tissue in relaxing solution containing 1% Triton X-100 (Thermo Fisher Scientific) and then homogenizing the tissue. The obtained cells were gently pelleted with a 3-min centrifugation at 500 rpm. This pellet was resuspended in relaxing solution, and this pelleting/resuspending procedure was repeated two more times. 3–4 cells from each of four WT and four TtnΔA164–167 male mice were studied.
Passive stress
For passive stress measurements, single cells were set to their slack sarcomere length (∼1.85 μm) and the cell was then lengthened at 1 length/s to an amplitude that varied from ∼1.9 to ∼2.4 µm. Once stretched, the cell was held at this new length for 10 s to allow for stress relaxation to occur, and the cell was then quickly released back to the slack length and held there for 10 s. This stretch–hold–release protocol was repeated until a range of SLs was achieved. From each stretch–hold–release protocol, the peak passive stress was obtained, the elastic stress value was obtained from the last 100 ms of the 10-s hold, and the viscous stress was obtained from the difference between peak stress and elastic stress. Six WT and six TtnΔA164–167 male mice were used, with six cells from each mouse tested.
Whole-muscle mechanics
Force–frequency and fatigability measurements
(Prosser et al., 2011) where P0min gives the minimum specific force, P0max gives the maximum specific force, F50 defines the frequency where P0 = 0.5 of P0max, and 1/k is a measure of the steepness of the P0 vs. F relationship. The curves for the different genotypes were also tested for significance using an extra sum-of-squares F test. For fatigue, an index was used, where the average of the last five values measured was divided by the average of the values from stimulations 2–6 (the first stimulation tends to produce highly variable force levels, with consistency being established at stimulation 2).
EDL central nucleus analysis
EDL muscles were dissected from three WT and three TtnΔA164–167 female mice and placed in Cryomolds. Before dissection from the leg, the approximate length of the muscle was measured (from its insertion point in the knee to the distal tendon). Once in the Cryomold, the muscle was stretched to a length as close to the in situ length as possible and pinned through the Cryomold. The muscles were then embedded in the Cryomolds in optimal cutting temperature (OCT) compound and immediately frozen in 2-methylbutane precooled in liquid nitrogen. Then, 10-mm cross-sections were cut from the center of the muscle and mounted onto microscope slides. Tissue sections were permeabilized in 0.2% Triton X-100/PBS for 20 min at room temperature, blocked with 2% bovine serum albumin (BSA) and 1% normal donkey serum in PBS for 1 h at 4°C, and incubated overnight at 4°C with rabbit anti-laminin antibody (L9393; Sigma-Aldrich) diluted in 50% blocking solution. Sections were washed with PBS two times for 5 min and incubated with Alexa Fluor 594 goat anti-rabbit secondary antibody (A11037; Invitrogen) diluted in 50% blocking solution for 3 h at room temperature. The sections were washed two times for 5 min with PBS, and coverslips were mounted with Vectashield Mounting Media with DAPI. Slides were imaged on a Zeiss Axio Imager M.1 microscope utilizing a Zeiss AxioCam MRc and 10 × magnification. The total number of fibers was counted using the MyoSight plugin for FIJI (Babcock et al., 2020), which also generates an image mask of the nuclei. The number of fibers containing central nuclei was then manually identified.
Echocardiography
Male WT (n = 8) and TtnΔA164–167 (n = 12) mice at 90 days of age were anesthetized with isoflurane, then placed in dorsal recumbence on a heated platform (body temperature: 37°C). Transthoracic echo images were obtained with a Vevo 2100 High-Resolution Imaging System (VisualSonics, Inc.) using the model MS550D scan head for cardiac. Care was taken to avoid animal contact with excessive pressure, which could induce bradycardia. Imaging was performed at a depth setting of ∼1 cm. Images were collected and stored as a digital cine loop for offline calculations. Standard imaging planes and functional calculations were obtained according to American Society of Echocardiography guidelines. The parasternal long-axis view and mid-wall cross-sectional view of the LV were used to guide calculations of percent fractional shortening, percent ejection fraction, and ventricular dimensions and volumes. The left atrial dimension was measured in the long-axis view directly below the aortic valve leaflets. Passive LV filling peak velocity, E (cm/s), and atrial contraction flow peak velocity, A (cm/s), were acquired from the images of mitral valve Doppler flow from tilted parasternal long-axis views. A sweep speed of 100 mm/s was used for M-mode and Doppler studies. The heart rates of animals during the echocardiographic study were maintained in the range of 500–550 beats/min for M-mode, 450–500 beats/min for B-mode, and 400–450 beats/min for Doppler studies (for details, see Table S2).
Cardiac histology
Hearts from three WT and three TtnΔA164–167 male and female mice were fixed in situ by formaldehyde perfusion to maintain all hearts at near diastasis. Mice were injected with 50–100 units of heparin 15–30 min before tissue collection. Mice were anesthetized with isoflurane and killed by cervical dislocation, followed by immediately opening the chest cavity. The femoral artery was then exposed and cut to open the circulatory system, and then, the apex of the heart was slowly injected with 3–4 ml of cardiac arrest solution (30 mM KCl, 30 mM 2,3-butanedione monoxime in 1X HEPES), followed by injection of 10 ml 10% buffered formalin by a syringe pump at a rate of 3 ml/min. Once the formalin injection finished, the heart was carefully removed and stored in 10% buffered formalin. The fixed hearts were processed for histological staining using a Leica ASP300S Tissue Processor. Each heart was cut into four equal transverse slices, and all four slices for each heart were embedded in one paraffin block. 5-μm sections were cut and mounted on glass microscope slides, followed by staining with Masson’s trichrome stain. Slides were imaged on a Zeiss Axio Imager M.1 microscope utilizing a Zeiss Axio Cam MRC and 20× magnification.
Immunoelectron microscopy
Ultrastructural labeling of the C-zone (cMyBP-C domains C5C7), titin P-zone (titin A168–170), and titin M-band (titin M8–M10) epitopes was performed on skinned LV papillary muscle from 3-mo-old male and female WT (2 mice per epitope) and TtnΔA164–167 mice (2 mice per epitope). Papillary fiber bundles were dissected and skinned in relaxing solution (in mM): 40 BES, 10 EGTA, 6.56 MgCl2, 5.88 Na-ATP, 1 DTT, 46.35 K-propionate, 15 creatine phosphate, pH 7.0, containing 1% Triton X-100, and protease inhibitors ([in mM]: 0.1 E64, 0.47 leupeptin, and 0.25 PMSF), then secured with aluminum T-clips, stretched by ∼20% from the slack length, and processed by the immunoelectron microscopy (IEM) pre-embedding technique previously described (Tonino et al., 2017). Cardiac fiber bundles were skinned twice, rinsed in relaxing solution with inhibitors, and immediately fixed with 3% paraformaldehyde in 10 mM PBS, pH 7.2, for 30 min at 4°C, followed by rinses with PBS and PBS containing protease inhibitors (0.04 mM E64 and 0.16 mM leupeptin), and incubation with glycine 50 mM in the same buffer. Blocking of muscle bundles was then performed with a solution of 0.5% BSA in PBS containing protease inhibitors and 0.05% Tween-20 for 1 h at 4°C. Afterward, muscle fiber bundles were incubated for 48 h at 4°C with rabbit polyclonal antibodies against the following titin domains: anti-titin A168–170 (TTN-8; Myomedix), anti-titin M8–M10 (TTN-9; Myomedix), and anti-cMyBP-C (domains C5C7), continued with three rinses in PBS containing protease inhibitors, and incubated with secondary goat anti-rabbit IgG antibody conjugated to Alexa Fluor 568 (ab175471; Invitrogen), overnight at 4°C. Negative controls were performed in fiber bundles by replacing each primary antibody with 0.5% BSA in PBS containing protease inhibitors. Subsequently, muscle bundles were fixed with 3% glutaraldehyde in 10 mM PBS, pH 7.2, for 30 min at 4°C, postfixed in 1% osmium tetroxide in the same buffer, and processed for routine transmission electron microscopy (TEM), as follows. Briefly, cardiac fiber bundles were dehydrated in an increased ethanol-graded series, infiltrated with propylene oxide and a mix of 1:1 propylene oxide: Araldite 502/Embed 812 resin, then transferred to three changes of fresh resin, embedded, and polymerized upside down in Beem capsules for 48 h at 60°C. Ultrathin (90 nm) longitudinal sections were obtained with a PowerTomeXL ultramicrotome (RMC Boeckeler Instruments, Inc.), collected on formvar-coated copper grids, and contrasted with 1% potassium permanganate and lead citrate. Images were registered in a Tecnai Spirit G2 BT transmission electron microscope with a side-mounted AMT Image Capture Engine V6.02 (4Mpix) digital camera operated at 100 kV. Digital images were calibrated with Fiji/ImageJ software 2.14.0v (NIH), and the density plot profiles were analyzed to determine the width of A-band, and titin A168–170, titin M8M10, and cMyBP-C epitope distances were measured across the M-band, as well as the distance between cMyBP-C stripes.
The sample preparation process for TEM is well known to cause shrinkage at the sarcomere level of around 10% (Sjöström and Squire, 1977; Sosa et al., 1994; Tonino et al., 2019); therefore, some fiber bundles were colabeled with an antibody against cMyBP-C (domains C5–C7) and its known spacing of 43 nm was used to generate a correction factor to apply to each sarcomere. However, for practical reasons, not all fiber bundles were dual-labeled, and in those sarcomeres, a correction factor based on sarcomere length, using a linear regression, was generated from the sarcomere length vs. correction factor plot from the experiments that did use cMyBP-C colabeling (Fig. S6 A). All length measurements obtained from IEM were corrected for shrinkage.
For cMyBP-C measurements, the distance from stripe 1 on one side of the sarcomere to the corresponding stripe 1 across the M-band was measured and halved to estimate its distance from the center of the sarcomere. The same process was done for stripe 9 so that the width and overall location of the C-zone could be estimated. The distance between at least 4 other stripes was measured and used to calculate the percent shrinkage of the sample based on the known distance between stripes of 43 nm. The known 43-nm distance was divided by the average measured distance to calculate a correction factor, by which all measurements for each sarcomere were multiplied.
Super-resolution structured illumination microscopy
WT (n = 3 per epitope) and TtnΔA164–167 (n = 3 per epitope) male and female mice aged 3 mo were used in the super-resolution structured illumination microscopy (SR-SIM) study. Experiments were performed as previously described (Tonino et al., 2019). Skinned cardiac fiber bundles (prepared as described above) were embedded in OCT compound and immediately frozen in 2-methylbutane precooled in liquid nitrogen. Then, 5-μm-thick cryosections were cut and mounted onto microscope slides. Tissue sections were permeabilized in 0.2% Triton X-100/PBS for 20 min at room temperature, blocked with 2% BSA and 1% normal donkey serum in PBS for 1 h at 4°C, and incubated overnight at 4°C with primary antibodies diluted in 50% blocking solution. The primary antibodies included (Table S1) the following (dilution: 1:200-1:300): a mouse monoclonal anti-titin “Ti102” antibody (domains I111–I112) (Jin, 1995), a rabbit polyclonal titin “MIR” antibody (domains I109–I111) (Myomedix) (Centner et al., 2000), a mouse monoclonal anti-α-actinin antibody (EA-53; Sigma-Aldrich), and a rabbit polyclonal anti-titin A77–A78 antibody (Bucher et al., 2010; Muhle-Goll et al., 2001). Sections were then washed with PBS two times for 30 min and incubated with secondary antibodies diluted in 50% blocking solution for 3 h at room temperature. The secondary antibodies (dilution: 1:200–1:300), obtained from Invitrogen and Abcam, included the following: Alexa Fluor 488–conjugated goat anti-mouse IgG, Alexa Fluor 568–conjugated goat anti-rabbit IgG, Alexa Fluor 568–conjugated goat anti-mouse IgG, and Alexa Fluor 568–conjugated donkey anti-rabbit IgG. The sections were then washed with PBS two times for 15 min and covered with number 1.5H coverslips using ProLong Glass Antifade Mountant (Thermo Fisher Scientific, Inc.). A Zeiss ELYRA S1 SR-SIM microscope was used with ultraviolet and solid-state laser (488/561/642 nm) illumination sources, a 100 × oil immersion objective (NA = 1.46) for 100× magnification, and a sCMOS camera. Typical imaging was performed on a 49.34 × 49.34 μm2 area with 1,280 × 1,280 pixel dimensions. Image stacks comprising 20 slices were acquired with 0.101-μm Z-steps, five angles, and five phases/angle for each slice. Image reconstruction and fluorescence intensity plot profile generation were performed with ZEN 2 software (Zeiss). Plot profiles were fit with Gaussian curves to determine the epitope peak position using Fityk 1.3.0 software. The Ti102 and A77–78 epitope positions were measured across the M-band and divided by 2 to approximate distance from the center of the sarcomere. There is negligible shrinkage of frozen samples prepared for immunofluorescence (Tonino et al., 2019), so no correction factor is applied to those measurements, which are expressed as average ± SD.
In silico titin stiffness
Statistics
Data were analyzed and visualized with GraphPad Prism 10.2.1. Results are expressed as mean ± SD. Two-tailed, unpaired t tests were used to compare two groups (titin and myosin protein ratios, muscle and body weight measurements, echocardiography data). Where multiple data points from the same mouse were considered, nested t tests or nested ANOVA (with Sidak’s multiple comparisons test) was used (SIM and IEM data, single EDL fibers, and cardiomyocytes). Two-way ANOVA or mixed-effects analyses (where appropriate, with repeated-measures correction and Sidak’s multiple comparisons rest) and/or curve fitting compared by an extra sum-of-squares F test was used to compare data that were analyzed as a relationship, i.e., sarcomere length–stress relationship, stress–calcium relationship, force–frequency relationship. P values <0.05 were considered statistically significant.
Online supplemental material
Fig. S1 shows details of the generation and characterization of the TtnΔA164–167 mouse model. Fig. S2 displays the plasmid used to generate the bait protein for pulldown assays and results of the assays. Fig. S3 shows analysis of centrally located nuclei in EDL muscle. Fig. S4 shows the soleus muscle functional data. Fig. S5 shows the WLC modeling results and intact EDL absolute force data. Fig. S6 shows the linear regression used to calculate IEM correction factors and epitope distance vs. sarcomere length relationships. Table S1 lists antigen, host species, concentration, and source details of the antibodies used for titin and cMyBP-C mapping. Table S2 lists all relevant measured echocardiography parameters.
Results
The TtnΔA164–167 mouse model
The TtnΔA164–167 mouse model was generated by making a deletion from the end of exon 337 to within exon 340 from the mouse titin gene using CRISPR/Cas9 to remove the sequence encoding domains A164–A167 (Fig. 1 A and Fig. S1 A). The A168–A170 segment of the P-zone, which houses a binding site for E3 ubiquitin ligases (Müller et al., 2021), was not disrupted. Homozygous TtnΔA164–167 mice are viable, are born to heterozygous parents at expected Mendelian genotype ratios, and have normal body weights and skeletal muscle weights (Fig. S1, B–E). RNA-sequencing analysis of the titin gene in adult LV myocardium and EDL muscle revealed that the correct exons are missing from titin transcripts in homozygous mice (Fig. 1, C and D). Titin splicing in LV was otherwise normal. In EDL muscle, we found slightly higher inclusion (14%) of M-band exon 5, and decreased exon inclusion in the I-band (Fig. 1 D). This is reflected in SDS-PAGE protein analysis, which demonstrates normal titin protein levels in adult LV and EDL muscles, but with a minor band of increased mobility in EDL, referred to as N2A-2 (Fig. 1 E). Altered I-band splicing in EDL muscle is a common phenomenon in mutant titin mice (van der Pijl et al., 2020), and could impact titin-based tension in myocytes (see below). The total amount of titin protein and its major degradation product T2 were measured in LV and EDL homogenates by optical density analysis of SDS-PAGE gels and normalized to the optical density of MHC (Fig. 1, F and G, respectively). These ratios in TtnΔA164–167 tissues were not different from WT tissues. As an initial evaluation of muscle function in the TtnΔA164–167 mouse model, we performed a front-limb grip strength assay and found that TtnΔA164–167 mice gripped with ∼30% less force relative to body weight than WT mice (Fig. 1 H), indicating that further investigation was warranted. Overall, characterization of the TtnΔA164–167 model at the RNA and protein level indicated it to be well suited for studying the role of titin’s P-zone domains A164–A167.
Potential binding partners
Since it is unknown whether titin’s P-zone domains A164–167 have binding partners, we performed pulldown assays to probe protein–protein interactions. We used a recombinantly expressed titin A164–167 bait protein with C-terminal ALFA and 10× histidine tags (Fig. S2 A) and performed the pulldown using the ALFA Selector ST system (Götzke et al., 2019). The bait protein was incubated with tissue lysate from WT LV or skeletal muscle (gastrocnemius complex due to its large size). Specific bands on the resulting SDS-PAGE gels following the pulldown were analyzed by mass spectrometry. A band that consistently appeared enriched in the skeletal muscle pulldown lanes and that was ∼100 kDa in molecular weight was identified by mass spectrometry to be most enriched in the protein SERCA1 (Fig. S2, B and C). Since we did not find mechanical changes indicative of altered calcium reuptake (see below) and it is known that SERCA1 localizes to the sarcoplasmic reticulum membrane (Wu et al., 1995), we interpreted this to be an artifact of the lysate conditions in which the pulldown assay is performed. Highly enriched in the pulldown lane from LV muscle was a band of ∼25 kDa, identified to contain adenine nucleotide transporter 1 (ANT1, also known as ADP/ATP translocase 1) (Fig. S2, B and C), which localizes to the inner mitochondrial membrane and exchanges ADP and ATP across the membrane (Willis et al., 2018); it is therefore unlikely to come into contact with titin. Western blots indicated no change in the overall levels of ANT1/2 in the TtnΔA164–167 LV and EDL lysates (Fig. S2, D and E). Thus, we did not pursue these hits as they are unlikely interactors of titin’s P-zone in the sarcomere.
Transcriptional changes in the TtnΔA164–167 mouse
We performed RNA sequencing to analyze transcriptomic changes in the LV and EDL tissue of TtnΔA164–167 mice. There were 1,964 DEGs in the LV tissue; 768 were upregulated and 1,196 were downregulated. We performed GO enrichment analysis of the top 300 DEGs (Fig. 2 A). In the molecular function category, significantly enriched terms were related to protein–protein and protein–ATP binding. In the biological process category, significantly enriched terms were related to metabolic processes, including glycolysis, fatty acid metabolism, and glycogen metabolism. This category also included positive regulation of the ERK1/2 signaling cascade, which is often associated with cardiac remodeling and response to stress (Nomura et al., 2018). The cellular component category included enrichment of terms related to mitochondrial components and extracellular matrix. Visualization of DEGs by volcano plot showed modest expression changes in TtnΔA164–167 LV relative to WT by log2 fold change (Fig. S1 F). Genes of interest are annotated and include a subset of markers of stress and hypertrophy. The most highly upregulated genes were Rny3 and Rny1, which are noncoding Y RNAs associated with inflammation and coronary artery disease (Repetto et al., 2015). Also upregulated are Col3a1 and Prkca, which are linked to fibrosis and hypertrophic remodeling (Herum et al., 2022; Braz et al., 2004; Muth et al., 2001). Other notable upregulated genes include Myh7, Myh7b, and Mybpc2, which align with expression patterns in diseased hearts (Nandi and Mishra, 2015; Dirkx et al., 2013; Del Gaudio et al., 2023). To verify whether there was a MHC expression switch at the protein level consistent with fetal gene reprogramming, we performed SDS-PAGE analysis, and found that TtnΔA164–167 LV, like WT, expresses exclusively α-myosin (Fig. 2 B). Together, the RNA-seq results in the TtnΔA164–167 LV indicate the differential expression of genes associated with stress and remodeling, as well as energetics and metabolism.
We also performed RNA sequencing on EDL tissue and analyzed the results similarly. TtnΔA164–167 EDL had 826 DEGs: 425 were upregulated and 401 were downregulated. Examination of the upregulated genes revealed strong increases in the expression of genes associated with slow muscle fiber types, including MYH (MyHC), troponin I, troponin C, myosin light chains, and cMyBP-C (Kedlian et al., 2024; Talbot and Maves, 2016). In conjunction with this, we found downregulation of the corresponding fast muscle fiber–associated genes. These results are represented as a heatmap in Fig. 2 C. Also upregulated were Ankrd1 and Ankrd2, which are typically associated with mechanical stress (Witt et al., 2005; Kojic et al., 2004; Kojic et al., 2011) (Fig. S1 G). Overall, the transcriptomic changes in the TtnΔA164–167 EDL were consistent with stress and compensation processes.
The marked upregulation of slow-twitch–associated genes and downregulation of fast-twitch–associated genes in the TtnΔA164–167 EDL prompted us to perform MyHC fiber typing by SDS-PAGE. This confirmed a shift toward slower MyHC paralogs in TtnΔA164–167 mice. WT EDL muscle contained 12% type IIA/IIX fibers and 88% type IIB fibers. TtnΔA164–167 EDL showed an increase in IIA/IIX myosin and decrease in IIB myosin, containing 26% IIA/IIX and 74% IIB fibers (Fig. 2 D). Thus, a mild but significant fiber-type switch (12% increase in slower IIA/IIX fiber content) is evident at the protein level in the EDL tissue, consistent with transcriptional changes.
Functional effects at the single myocyte level
In EDL muscle of TtnΔA164–167 mice, inclusion of titin’s I-band exons was significantly reduced. This change is predicted to increase strain on the extensible I-band segment for a given sarcomere stretch, thereby elevating passive stress. To quantify this effect, we applied a serially linked WLC model of titin’s extensible I-band segment (see Materials and methods). Modeling predicted a marked increase in passive stress, particularly at sarcomere lengths exceeding ∼3.0 µm (Fig. S5 A). An additional phenotype in TtnΔA164–167 mice was a ∼43-nm reduction in thick filament length per half-sarcomere (see below), which is likewise predicted to further raise passive stress (Fig. S5 A). A similar WLC-based simulation was performed for cardiac muscle, where no change in I-band exon splicing was detected; here, the ∼43-nm half-filament shortening alone was predicted to increase passive force (Fig. S5 B).
E D L W L C Passive Force Model: The line graph models the passive force generated by a single titin molecule in the E D L (Extensor Digitorum Longus) muscle. The horizontal axis represents the Sarcomere length (nanometers), ranging from 1600 to 3400 nanometers with increments of 200 nanometers. The vertical axis represents the Force per titin molecule (piconewton), ranging from 0 to 50 piconewton with increments of 10 piconewton. The graph displays three exponential curves that begin to rise sharply after 2400 nanometers. The bottom black line (W T) reaches a maximum force of approximately 10 piconewton at the longest sarcomere length. The middle light red line (Ttn Delta A164-167 splicing) reaches approximately 28 piconewton, with an upward arrow indicating the contribution of Splicing. L V W L C Passive Force Model: This line graph models the passive force in the L V (Left Ventricle) cardiac muscle. The horizontal axis represents Sarcomere length (nanometers), with a smaller physiological range from 1600 to 2400 nanometers in increments of 100 nanometers. The vertical axis represents Force per titin molecule (piconewton), ranging from 0 to 8 piconewton with increments of 2 piconewton. Two exponential curves are shown, both remaining at 0 piconewton until roughly 1750 nanometers. The lower black line (W T) rises to approximately 4.2 piconewton at a length of 2400 nanometers. The upper red line (Ttn Delta A164-167 thick filament) rises more steeply, reaching approximately 6.0 piconewton at the same length. A red upward arrow indicates that this increase in force is due to Thick filament shortening. E D L Absolute Force Graph: This sigmoid line graph compares the contractile force of the E D L muscle across different stimulation frequencies. The horizontal axis represents frequency in Hertz, ranging from 0 to 250 Hertz with major increments of 50 Hertz. The vertical axis represents absolute force in milliNewtons, ranging from 0 to 400 milliNewtons with increments of 100 milliNewtons. The gray line (W T) starts at approximately 60 milliNewtons and rises sharply between 25 and 100 Hertz, reaching a plateau at roughly 380 milliNewtons. The blue line (Ttn Delta A164-167) starts lower at approximately 40 milliNewtons and follows a similar curve, but plateaus significantly lower at approximately 250 milliNewtons. Each data point includes error bars for standard deviation. The space between the two curves is marked with asterisks at every frequency from 10 to 250 Hertz. All values are approximate.
Computational modeling of passive tension based on WLC model and intact EDL absolute force generation. (A) Sarcomere length vs. force plot for a single titin molecule in WT EDL sarcomere, a sarcomere in which only the TtnΔA164–167 EDL splicing differences are present, and a sarcomere in which the splicing differences and 86-nm shorter thick filament found in TtnΔA164–167 are present. (B) Sarcomere length vs. force plot for a single titin molecule in a WT LV sarcomere and the TtnΔA164–167 sarcomere in which the thick filament is 86 nm shorter. (C) Force–frequency relationship of intact EDL muscles expressed as absolute force values. 5–6 mice of each genotype were used. Statistical significance was determined by two-way repeated-measures ANOVA with Sidak’s multiple comparisons test.**p ≤ 0.01; ***p ≤ 0.001; **** p ≤ 0.0001.
E D L W L C Passive Force Model: The line graph models the passive force generated by a single titin molecule in the E D L (Extensor Digitorum Longus) muscle. The horizontal axis represents the Sarcomere length (nanometers), ranging from 1600 to 3400 nanometers with increments of 200 nanometers. The vertical axis represents the Force per titin molecule (piconewton), ranging from 0 to 50 piconewton with increments of 10 piconewton. The graph displays three exponential curves that begin to rise sharply after 2400 nanometers. The bottom black line (W T) reaches a maximum force of approximately 10 piconewton at the longest sarcomere length. The middle light red line (Ttn Delta A164-167 splicing) reaches approximately 28 piconewton, with an upward arrow indicating the contribution of Splicing. L V W L C Passive Force Model: This line graph models the passive force in the L V (Left Ventricle) cardiac muscle. The horizontal axis represents Sarcomere length (nanometers), with a smaller physiological range from 1600 to 2400 nanometers in increments of 100 nanometers. The vertical axis represents Force per titin molecule (piconewton), ranging from 0 to 8 piconewton with increments of 2 piconewton. Two exponential curves are shown, both remaining at 0 piconewton until roughly 1750 nanometers. The lower black line (W T) rises to approximately 4.2 piconewton at a length of 2400 nanometers. The upper red line (Ttn Delta A164-167 thick filament) rises more steeply, reaching approximately 6.0 piconewton at the same length. A red upward arrow indicates that this increase in force is due to Thick filament shortening. E D L Absolute Force Graph: This sigmoid line graph compares the contractile force of the E D L muscle across different stimulation frequencies. The horizontal axis represents frequency in Hertz, ranging from 0 to 250 Hertz with major increments of 50 Hertz. The vertical axis represents absolute force in milliNewtons, ranging from 0 to 400 milliNewtons with increments of 100 milliNewtons. The gray line (W T) starts at approximately 60 milliNewtons and rises sharply between 25 and 100 Hertz, reaching a plateau at roughly 380 milliNewtons. The blue line (Ttn Delta A164-167) starts lower at approximately 40 milliNewtons and follows a similar curve, but plateaus significantly lower at approximately 250 milliNewtons. Each data point includes error bars for standard deviation. The space between the two curves is marked with asterisks at every frequency from 10 to 250 Hertz. All values are approximate.
Computational modeling of passive tension based on WLC model and intact EDL absolute force generation. (A) Sarcomere length vs. force plot for a single titin molecule in WT EDL sarcomere, a sarcomere in which only the TtnΔA164–167 EDL splicing differences are present, and a sarcomere in which the splicing differences and 86-nm shorter thick filament found in TtnΔA164–167 are present. (B) Sarcomere length vs. force plot for a single titin molecule in a WT LV sarcomere and the TtnΔA164–167 sarcomere in which the thick filament is 86 nm shorter. (C) Force–frequency relationship of intact EDL muscles expressed as absolute force values. 5–6 mice of each genotype were used. Statistical significance was determined by two-way repeated-measures ANOVA with Sidak’s multiple comparisons test.**p ≤ 0.01; ***p ≤ 0.001; **** p ≤ 0.0001.
Mechanical experiments were conducted on skinned single fibers dissected from EDL muscle. To enable direct comparison across samples, all fibers used for mechanical testing were fiber-typed by SDS-PAGE, and only the results from type IIB fibers were analyzed. Passive Stress Measurements—Passive stress was assessed by imposing a ramp stretch–hold–release protocol and recording the resulting stress. TtnΔA164–167 fibers generated greater peak passive stress than WT (Fig. 3 A), particularly at long sarcomere lengths (3.4–3.6 μm), when analyzed by nested ANOVA. The elastic component of passive stress was also elevated at long sarcomere lengths in TtnΔA164–167 fibers (Fig. 3 B), while the viscous component trended higher (Fig. 3 C). Note that the exponential curve fits, when tested by an extra sum-of-squares F test, were different between WT and TtnΔA164–167 for peak, elastic, and viscous passive stress. These findings align with the reduced exon inclusion in titin’s I-band segment, which is predicted to increase passive stress. Active Stress Measurements—Maximal Ca2+ activation revealed no difference in active stress (force normalized to CSA) between TtnΔA164–167 and WT fibers (Fig. 3 D). However, the CSA of TtnΔA164–167 fibers was ∼30% smaller than WT, and a ∼30% decrease in absolute force was measured in association with this (Fig. 3 E and Fig. S5 C). The Ktr following a slack–stretch during activation was unchanged (Fig. 3 F). Furthermore, the stress–Ca2+ relationship was similar between genotypes, with no shift in EC50 (Fig. 3 G). In summary, single-fiber mechanical experiments demonstrate that type IIB EDL fibers from TtnΔA164–167 mice have normal active mechanical properties, reduced CSA, and significantly elevated passive stress compared with WT fibers.
Graph A: Peak Passive Stress: This line graph illustrates the Peak Passive Stress of the muscle fibers. The horizontal axis represents Sarcomere Length measured in micrometers, ranging from 2.4 to 3.6 micrometers with increments of 0.2 micrometers. The vertical axis represents Stress measured in milliNewtons per square millimeter, ranging from 0 to 80 with increments of 20. The graph displays two upward-curving lines: a gray line for W T and a blue line for Ttn Delta A164-167. Both lines start near 0 milliNewtons per square millimeter at a length of 2.5 micrometers. As length increases, the blue mutant line rises more steeply than the gray W T line. The overall curve difference is noted as p less than 0.0001. Graph B: Elastic Passive Stress. This graph shows the Elastic Passive Stress component, which represents the force that returns to baseline after a stretch. The axes, ranges, and increments are identical to Graph A, with the horizontal axis in micrometers and the vertical axis in milliNewtons per square millimeter. Two lines are plotted: a gray W T line and a blue mutant line. Similar to the peak stress, the lines diverge as the sarcomere is stretched beyond 3.0 micrometers. The blue line consistently sits above the gray line, reaching a maximum of approximately 40 Millinewtons per square millimetre at a length of 3.6 micrometers, compared to roughly 28 Millinewtons per square millimetre for the W T. Statistical significance is indicated at the 3.5 and 3.6 micrometers marks with asterisks, and the curve difference is labeled p less than 0.0001. Graph C: Viscous Passive Stress represents the Viscous Passive Stress, which accounts for the internal friction or decay of force within the muscle during stretch. The horizontal axis (Sarcomere Length in micrometers) and vertical axis (Stress in milliNewtons per square millimeter) maintain the same scales as the previous graphs. Both the gray W T line and the blue mutant line show much lower values here than in the peak or elastic graphs. Both lines stay near 0 millinewtons per square millimetre until roughly 3.2 micrometers. At the maximum stretch of 3.6 micrometers, the stress for both groups is low, with the mutant line at approximately 12 Millinewtons per square millimetre and the WT line at approximately 8 Millinewtons per square millimetre. While the blue line is slightly higher, the statistical difference between these curves is noted as p less than 0.0001. Graph D: Active Stress. This bar graph displays the Active Stress generated by the muscle fibers. The vertical axis represents Stress, measured in millinewtons per square millimeter, with a range of 0 to 300 and increments of 100. The horizontal axis identifies the two groups: W T (represented by a gray bar) and Ttn Delta A164-167 (represented by a blue bar). Both bars reach an average height of approximately 160 millinewtons per square millimeter. Numerous individual data points are plotted as dots over both bars, and error bars indicate the standard deviation. A bracket at the top is labeled ns (not significant), indicating that there is no statistical difference in active stress production between the two genotypes. Graph E: Cross-sectional area (C S A): This bar graph compares the Cross-sectional area of the individual muscle fibers. The vertical axis represents C S A measured in square millimeters, ranging from 0.0000 to 0.0025 with increments of 0.0005. The W T group (gray bar) has an average C S A of approximately 0.0017 square millimeters, while the Ttn Delta A164-167 group (blue bar) is visibly lower with an average of approximately 0.0012 square millimeters. Individual data points show a clear downward shift in the mutant group. A bracket above the bars is marked with two asterisks, signifying a statistically significant decrease in fiber size in the mutant mice compared to the wild-type. Graph F: K tr (Rate of Tension Redevelopment). This bar graph illustrates the K tr, which measures the rate of tension redevelopment in the fibers. The vertical axis represents K tr measured in reciprocal seconds, ranging from 0 to 15 with increments of 5. The WT gray bar and the Ttn Delta A164-167 blue bar both plateau at a mean value of approximately 9 reciprocal seconds. The distribution of individual data points and the standard deviation error bars are nearly identical for both groups. The graph is topped with a bracket labeled ns, confirming that the mutation does not significantly impact the kinetics of tension redevelopment in these skeletal muscle fibers. Graph G: Stress-Calcium relationship: The main sigmoid line graph plots Normalized Stress on the vertical axis, ranging from 0.0 to 1.0 in increments of 0.2, against Free C a 2 plus concentration on the horizontal axis, ranging from 0 to 5 micromolar with increments of 1. Both the gray line (W T) and the blue line (Ttn Delta A164-167) show a steep increase in stress between 0.5 micromolar and 2.0 micromolar before plateauing at a normalized stress value of 1.0, indicating that the mutation does not alter the fundamental stress-calcium curve. An inset bar graph quantifies the Ca 2 plus E C 50 values, which represent the calcium concentration required to reach half-maximal stress. The vertical axis for this inset is measured in micromolar from 0.0 to 2.0 with increments of 0.5, and both the gray W T bar and the blue mutant bar plateau at a mean value of approximately 1.1 micromolar. Numerous individual data points are scattered across both bars, and a bracket labeled n s confirms there is no statistically significant difference in calcium sensitivity between the two genotypes. All values are approximate.
Single EDL fiber mechanics. (A) Peak passive stress produced by single skinned EDL fibers across a range of sarcomere lengths. (B) Elastic component of passive stress. (C) Viscous component of passive stress. Statistical significance for A–C was determined by nested ANOVA with Sidak’s multiple comparisons test (represented by asterisks) and exponential growth curve fitting with an extra sum-of-squares F test (P value listed on plot). (D) Maximal active stress produced by single skinned EDL muscle fibers. (E) CSA of EDL fibers used in single-fiber mechanical experiments. (F) Ktr of single skinned EDL fibers. (G) Average stress–calcium relationship of skinned EDL fibers. Statistical significance for D–G inset was determined by nested t test (nested by mouse). Statistical significance for curve fit in G was determined by an extra sum-of-squares F test. For panel A–F experiments, 3 WT and 3 TtnΔA164–167 mice were used, with 3–8 fibers per mouse tested. For panel G, 2 WT and 2 TtnΔA164–167 mice were used, with 5–8 fibers per mouse tested. ns, p ≥ 0.05; **p ≤ 0.01.
Graph A: Peak Passive Stress: This line graph illustrates the Peak Passive Stress of the muscle fibers. The horizontal axis represents Sarcomere Length measured in micrometers, ranging from 2.4 to 3.6 micrometers with increments of 0.2 micrometers. The vertical axis represents Stress measured in milliNewtons per square millimeter, ranging from 0 to 80 with increments of 20. The graph displays two upward-curving lines: a gray line for W T and a blue line for Ttn Delta A164-167. Both lines start near 0 milliNewtons per square millimeter at a length of 2.5 micrometers. As length increases, the blue mutant line rises more steeply than the gray W T line. The overall curve difference is noted as p less than 0.0001. Graph B: Elastic Passive Stress. This graph shows the Elastic Passive Stress component, which represents the force that returns to baseline after a stretch. The axes, ranges, and increments are identical to Graph A, with the horizontal axis in micrometers and the vertical axis in milliNewtons per square millimeter. Two lines are plotted: a gray W T line and a blue mutant line. Similar to the peak stress, the lines diverge as the sarcomere is stretched beyond 3.0 micrometers. The blue line consistently sits above the gray line, reaching a maximum of approximately 40 Millinewtons per square millimetre at a length of 3.6 micrometers, compared to roughly 28 Millinewtons per square millimetre for the W T. Statistical significance is indicated at the 3.5 and 3.6 micrometers marks with asterisks, and the curve difference is labeled p less than 0.0001. Graph C: Viscous Passive Stress represents the Viscous Passive Stress, which accounts for the internal friction or decay of force within the muscle during stretch. The horizontal axis (Sarcomere Length in micrometers) and vertical axis (Stress in milliNewtons per square millimeter) maintain the same scales as the previous graphs. Both the gray W T line and the blue mutant line show much lower values here than in the peak or elastic graphs. Both lines stay near 0 millinewtons per square millimetre until roughly 3.2 micrometers. At the maximum stretch of 3.6 micrometers, the stress for both groups is low, with the mutant line at approximately 12 Millinewtons per square millimetre and the WT line at approximately 8 Millinewtons per square millimetre. While the blue line is slightly higher, the statistical difference between these curves is noted as p less than 0.0001. Graph D: Active Stress. This bar graph displays the Active Stress generated by the muscle fibers. The vertical axis represents Stress, measured in millinewtons per square millimeter, with a range of 0 to 300 and increments of 100. The horizontal axis identifies the two groups: W T (represented by a gray bar) and Ttn Delta A164-167 (represented by a blue bar). Both bars reach an average height of approximately 160 millinewtons per square millimeter. Numerous individual data points are plotted as dots over both bars, and error bars indicate the standard deviation. A bracket at the top is labeled ns (not significant), indicating that there is no statistical difference in active stress production between the two genotypes. Graph E: Cross-sectional area (C S A): This bar graph compares the Cross-sectional area of the individual muscle fibers. The vertical axis represents C S A measured in square millimeters, ranging from 0.0000 to 0.0025 with increments of 0.0005. The W T group (gray bar) has an average C S A of approximately 0.0017 square millimeters, while the Ttn Delta A164-167 group (blue bar) is visibly lower with an average of approximately 0.0012 square millimeters. Individual data points show a clear downward shift in the mutant group. A bracket above the bars is marked with two asterisks, signifying a statistically significant decrease in fiber size in the mutant mice compared to the wild-type. Graph F: K tr (Rate of Tension Redevelopment). This bar graph illustrates the K tr, which measures the rate of tension redevelopment in the fibers. The vertical axis represents K tr measured in reciprocal seconds, ranging from 0 to 15 with increments of 5. The WT gray bar and the Ttn Delta A164-167 blue bar both plateau at a mean value of approximately 9 reciprocal seconds. The distribution of individual data points and the standard deviation error bars are nearly identical for both groups. The graph is topped with a bracket labeled ns, confirming that the mutation does not significantly impact the kinetics of tension redevelopment in these skeletal muscle fibers. Graph G: Stress-Calcium relationship: The main sigmoid line graph plots Normalized Stress on the vertical axis, ranging from 0.0 to 1.0 in increments of 0.2, against Free C a 2 plus concentration on the horizontal axis, ranging from 0 to 5 micromolar with increments of 1. Both the gray line (W T) and the blue line (Ttn Delta A164-167) show a steep increase in stress between 0.5 micromolar and 2.0 micromolar before plateauing at a normalized stress value of 1.0, indicating that the mutation does not alter the fundamental stress-calcium curve. An inset bar graph quantifies the Ca 2 plus E C 50 values, which represent the calcium concentration required to reach half-maximal stress. The vertical axis for this inset is measured in micromolar from 0.0 to 2.0 with increments of 0.5, and both the gray W T bar and the blue mutant bar plateau at a mean value of approximately 1.1 micromolar. Numerous individual data points are scattered across both bars, and a bracket labeled n s confirms there is no statistically significant difference in calcium sensitivity between the two genotypes. All values are approximate.
Single EDL fiber mechanics. (A) Peak passive stress produced by single skinned EDL fibers across a range of sarcomere lengths. (B) Elastic component of passive stress. (C) Viscous component of passive stress. Statistical significance for A–C was determined by nested ANOVA with Sidak’s multiple comparisons test (represented by asterisks) and exponential growth curve fitting with an extra sum-of-squares F test (P value listed on plot). (D) Maximal active stress produced by single skinned EDL muscle fibers. (E) CSA of EDL fibers used in single-fiber mechanical experiments. (F) Ktr of single skinned EDL fibers. (G) Average stress–calcium relationship of skinned EDL fibers. Statistical significance for D–G inset was determined by nested t test (nested by mouse). Statistical significance for curve fit in G was determined by an extra sum-of-squares F test. For panel A–F experiments, 3 WT and 3 TtnΔA164–167 mice were used, with 3–8 fibers per mouse tested. For panel G, 2 WT and 2 TtnΔA164–167 mice were used, with 5–8 fibers per mouse tested. ns, p ≥ 0.05; **p ≤ 0.01.
We next performed single skinned cardiomyocyte mechanical experiments. Passive Stress Measurements—Relaxed cardiomyocytes were subjected to a ramp stretch–hold–release protocol to measure passive stress. Peak passive stress was measured at a range of sarcomere lengths, and the elastic and viscous components were calculated. The sarcomere length–stress relationship was plotted for each component and fit to an exponential growth curve. TtnΔA164–167 cardiomyocytes generated slightly higher passive stress as indicated by significantly different curve fits tested by an extra sum-of-squares F test (Fig. 4, A–C). Active Stress Measurements—The stress produced by skinned cardiomyocytes maximally activated with calcium was also measured but was not different between controls and TtnΔA164–167 mice (Fig. 4 D). We tested the stress–Ca2+ relationship and found that calcium sensitivity, as indicated by EC50, was not different in TtnΔA164–167 mice compared with controls (Fig. 4 E). Cardiomyocyte studies therefore indicated that active stress and calcium sensitivity are unaffected in TtnΔA164–167 mice, but that passive stress is mildly increased.
Graph A: Peak Passive Stress. This line graph displays the Peak Passive Stress of the cardiac fibers. The horizontal axis represents Sarcomere Length in micrometers, ranging from 1.8 to 2.3 micrometers with increments of 0.1 micrometers. The vertical axis represents Stress in milliNewtons per square millimeter, ranging from 0 to 10 with increments of 2. Two upward-curving lines are shown: a gray W T line and a blue mutant line. Both lines start near 0.2 millinewtons per square millimetre at a length of 1.85 micrometers. The blue line rises slightly higher than the gray line as the sarcomere is stretched, reaching approximately 8 millinewtons per square millimetre at the final length of 2.32 micrometers, while the W T reaches roughly 7.2 millinewtons per square millimetre. The difference between these curves is statistically significant, labeled as p equals 0.0057. Graph B: Elastic Stress. This graph illustrates the Elastic Stress component of the cardiac fibers. The horizontal and vertical axes, ranges, and increments are identical to Graph A. The gray W T line and blue mutant line follow a similar upward trend as the peak stress. The blue mutant line consistently maintains a slightly higher position than the gray line throughout the stretch. At the maximum sarcomere length of 2.32 micrometers, the elastic stress is approximately 6 millinewtons per square millimetre for the mutant and 5 millinewtons per square millimetre for the W T. The statistical significance for the difference between these two curves is noted as p equals 0.0005. Graph C: Viscous Stress. This graph displays the Viscous Stress component, which reflects the internal resistance of the cardiac muscle during stretch. The horizontal and vertical axes remain on the same scale as the previous two graphs. Both the gray W T line and the blue mutant line remain quite low compared to peak or elastic stress, staying below 1 millinewtons per square millimetre until the sarcomere length exceeds 2.1 micrometers. At the final stretch point of 2.32 micrometers, both lines reach approximately 2.5 millinewtons per square millimetre, with the blue line overlapping or sitting marginally above the gray line. The curve difference is labeled p greater than 0.05, indicating that there is no statistically significant difference in viscous stress between the wild-type and mutant cardiac fibers. Panel D: Maximal Active Stress. This bar graph illustrates the Maximal Active Stress generated by cardiac muscle fibers. The vertical axis represents Stress measured in milliNewtons per square millimeter, ranging from 0 to 80 with increments of 20. The horizontal axis compares the WT group (gray bar) and the Ttn Delta A164-167 group (blue bar). Both bars reach a nearly identical mean height of approximately 32 milliNewtons per square millimeter. Numerous individual data points are scattered over both bars, and error bars indicate the standard deviation. A bracket at the top labeled ns confirms that there is no statistically significant difference in maximal active stress production between the wild-type and mutant cardiac fibers. Panel E: Stress-Calcium Relationship. This panel features a sigmoid line graph showing the relationship between free calcium and muscle stress, with an inset quantifying calcium sensitivity. Main Graph: The horizontal axis represents Free Calcium concentration measured in micromolar on a logarithmic scale ranging from 0.1 to 100. The vertical axis represents Stress in milliNewtons per square millimeter, ranging from 0 to 40 with increments of 10. The gray line (W T) and blue line (Ttn Delta A164-167) follow almost identical paths, rising sharply between 1 micromolar and 10 micromolar before plateauing at a maximum stress of approximately 31 milliNewtons per square millimeter. Inset Graph (Ca 2 plus E C 50): This bar graph shows the concentration of calcium required to reach 50 percent maximal stress. The vertical axis is measured in micromolar from 0 to 4. Both the gray W T bar and the blue mutant bar plateau at a mean value of approximately 2.2 micromolar. A bracket labeled ns indicates that there is no statistically significant difference in cardiac calcium sensitivity between the two genotypes. All values are approximate.
Cardiomyocyte mechanics. (A) Peak stress generated by cardiomyocytes passively stretched to a range of sarcomere lengths. (B) Elastic component of passive stress. (C) Viscous component of passive stress. Statistical significance for A–C was determined by mixed-effects analysis at each sarcomere length (no significance found) and exponential growth curve fitting with an extra sum-of-squares F test (P value on plot). 6 WT and 6 TtnΔA164–167 mice were used, with 6 cells tested per animal. (D) Maximal active stress measurements from individual cardiomyocytes. Four animals per genotype were used, with six cells tested per animal. Statistical significance was determined by nested t test (nested by mouse). (E) Stress–Ca2+ relationship, with EC50 measured in individual cell inset. The stress–Ca2+ curve was fit with a Hill equation, and statistical significance of curve fit was determined by an extra sum-of-squares F test. Statistical significance of EC50 was determined by a nested t test (nested by mouse). 4 WT and 4 TtnΔA164–167 mice were used, with 3–4 cells tested per mouse.
Graph A: Peak Passive Stress. This line graph displays the Peak Passive Stress of the cardiac fibers. The horizontal axis represents Sarcomere Length in micrometers, ranging from 1.8 to 2.3 micrometers with increments of 0.1 micrometers. The vertical axis represents Stress in milliNewtons per square millimeter, ranging from 0 to 10 with increments of 2. Two upward-curving lines are shown: a gray W T line and a blue mutant line. Both lines start near 0.2 millinewtons per square millimetre at a length of 1.85 micrometers. The blue line rises slightly higher than the gray line as the sarcomere is stretched, reaching approximately 8 millinewtons per square millimetre at the final length of 2.32 micrometers, while the W T reaches roughly 7.2 millinewtons per square millimetre. The difference between these curves is statistically significant, labeled as p equals 0.0057. Graph B: Elastic Stress. This graph illustrates the Elastic Stress component of the cardiac fibers. The horizontal and vertical axes, ranges, and increments are identical to Graph A. The gray W T line and blue mutant line follow a similar upward trend as the peak stress. The blue mutant line consistently maintains a slightly higher position than the gray line throughout the stretch. At the maximum sarcomere length of 2.32 micrometers, the elastic stress is approximately 6 millinewtons per square millimetre for the mutant and 5 millinewtons per square millimetre for the W T. The statistical significance for the difference between these two curves is noted as p equals 0.0005. Graph C: Viscous Stress. This graph displays the Viscous Stress component, which reflects the internal resistance of the cardiac muscle during stretch. The horizontal and vertical axes remain on the same scale as the previous two graphs. Both the gray W T line and the blue mutant line remain quite low compared to peak or elastic stress, staying below 1 millinewtons per square millimetre until the sarcomere length exceeds 2.1 micrometers. At the final stretch point of 2.32 micrometers, both lines reach approximately 2.5 millinewtons per square millimetre, with the blue line overlapping or sitting marginally above the gray line. The curve difference is labeled p greater than 0.05, indicating that there is no statistically significant difference in viscous stress between the wild-type and mutant cardiac fibers. Panel D: Maximal Active Stress. This bar graph illustrates the Maximal Active Stress generated by cardiac muscle fibers. The vertical axis represents Stress measured in milliNewtons per square millimeter, ranging from 0 to 80 with increments of 20. The horizontal axis compares the WT group (gray bar) and the Ttn Delta A164-167 group (blue bar). Both bars reach a nearly identical mean height of approximately 32 milliNewtons per square millimeter. Numerous individual data points are scattered over both bars, and error bars indicate the standard deviation. A bracket at the top labeled ns confirms that there is no statistically significant difference in maximal active stress production between the wild-type and mutant cardiac fibers. Panel E: Stress-Calcium Relationship. This panel features a sigmoid line graph showing the relationship between free calcium and muscle stress, with an inset quantifying calcium sensitivity. Main Graph: The horizontal axis represents Free Calcium concentration measured in micromolar on a logarithmic scale ranging from 0.1 to 100. The vertical axis represents Stress in milliNewtons per square millimeter, ranging from 0 to 40 with increments of 10. The gray line (W T) and blue line (Ttn Delta A164-167) follow almost identical paths, rising sharply between 1 micromolar and 10 micromolar before plateauing at a maximum stress of approximately 31 milliNewtons per square millimeter. Inset Graph (Ca 2 plus E C 50): This bar graph shows the concentration of calcium required to reach 50 percent maximal stress. The vertical axis is measured in micromolar from 0 to 4. Both the gray W T bar and the blue mutant bar plateau at a mean value of approximately 2.2 micromolar. A bracket labeled ns indicates that there is no statistically significant difference in cardiac calcium sensitivity between the two genotypes. All values are approximate.
Cardiomyocyte mechanics. (A) Peak stress generated by cardiomyocytes passively stretched to a range of sarcomere lengths. (B) Elastic component of passive stress. (C) Viscous component of passive stress. Statistical significance for A–C was determined by mixed-effects analysis at each sarcomere length (no significance found) and exponential growth curve fitting with an extra sum-of-squares F test (P value on plot). 6 WT and 6 TtnΔA164–167 mice were used, with 6 cells tested per animal. (D) Maximal active stress measurements from individual cardiomyocytes. Four animals per genotype were used, with six cells tested per animal. Statistical significance was determined by nested t test (nested by mouse). (E) Stress–Ca2+ relationship, with EC50 measured in individual cell inset. The stress–Ca2+ curve was fit with a Hill equation, and statistical significance of curve fit was determined by an extra sum-of-squares F test. Statistical significance of EC50 was determined by a nested t test (nested by mouse). 4 WT and 4 TtnΔA164–167 mice were used, with 3–4 cells tested per mouse.
Functional effects at the organ level
Skeletal muscle
Front-limb grip strength assays indicated that TtnΔA164–167 mice were weaker than controls (Fig. 1 H), so we proceeded with ex vivo whole-muscle mechanical experiments to test the function of a representative fast-twitch muscle, EDL. The EDLs from WT and TtnΔA164–167 mice were stimulated at frequencies ranging from 1 Hz (twitch) to 250 Hz (maximal tetanus). TtnΔA164–167 EDLs produced less specific force (force normalized to PCSA) than WT controls at all stimulation frequencies. The maximal specific force (250 Hz) generated by TtnΔA164–167 EDLs was, on average, 28% less than WT EDLs (Fig. 5 A), but the frequency at which 50% of the maximal force was produced, F50, was not changed in TtnΔA164–167 EDLs (Fig. 5 B). We noted that the PCSA of the TtnΔA164–167 EDLs was significantly smaller than WT (Fig. 5 A inset), and therefore also compared the absolute EDL force generation (not normalized to PCSA). Maximal absolute force was decreased to a larger degree in TtnΔA164–167 EDLs than specific force, with an average decrease of 35% compared with WT EDLs (Fig. S5 C). Twitch (1 Hz) stimulations were used to study contraction and relaxation kinetics and showed that maximal rate of contraction (max dx/dt) was decreased in TtnΔA164–167 EDLs compared with WT, but maximal relaxation rate (minimum dx/dt) was unaffected (Fig. 5, C and D). The EDL muscles also underwent a fatigue experiment, in which they were rapidly stimulated 75 times at a frequency of 60 Hz. Fatigue index, defined here as the ratio of the average force produced by the last five stimulations to the average force produced by the first five stimulations, was used to indicate fatigue resistance. TtnΔA164–167 EDLs had an increased fatigue index, indicating increased resistance to fatigue compared with WT EDLs (Fig. 5 E). Because muscle weakness with fiber-type shifting can be a myopathic phenotype, we examined EDL cross-sections for the presence of central nuclei, a prominent myopathy marker. There was no difference in the proportion of fibers with central nuclei between the genotypes, with an average of 2% of TtnΔA164–167 and 0.8% of WT fibers containing central nuclei (Fig. S3). Thus, the EDL muscles of TtnΔA164–167 mice are weaker and have kinetic and fatigability changes consistent with the gene and protein expression shift toward a slow-like phenotype, but with no overt signs of myopathy.
Panel A: E D L Force-Frequency Curve: This line graph illustrates the relationship between stimulation frequency and muscle force production in the Extensor Digitorum Longus muscle. The horizontal axis represents the stimulation frequency measured in Hertz, ranging from 0 to 250 Hertz with major increments of 50 Hertz. The vertical axis represents Specific force measured in milliNewtons per square millimeter, ranging from 0 to 350 with increments of 50. A gray line represents the W T (Wild-Type) group, which rises from roughly 40 milliNewtons per square millimeter at low frequencies to a plateau of approximately 275 milliNewtons per square millimeter at 250 Hertz. A blue line represents the Ttn Delta A164-167 mutant group, which starts lower and plateaus significantly lower at roughly 200 milliNewtons per square millimeter. The gap between the two curves is marked with an asterisk at every data point, indicating high statistical significance, with a general curve p-value less than 0.0001. An inset horizontal bar graph shows the P C S A (Physiological Cross-Sectional Area) in square millimeters from 0.0 to 1.5; the blue mutant bar is significantly shorter than the gray W T bar, marked with a single asterisk. Panel B: F 50 Frequency Analysis: This bar graph quantifies the F 50, which is the frequency required to reach 50 percent of the maximum specific force. The vertical axis represents frequency in Hertz, ranging from 0 to 80 with increments of 20. The W T group (gray bar) and the Ttn Delta A164-167 group (blue bar) both reach a mean value of approximately 60 Hertz. Individual data points for both groups are clustered around this mean, and a bracket at the top labeled ns indicates that there is no statistically significant difference in the F 50 values between the two genotypes. Panel C (Max Rate Cont.): This bar graph measures the Maximum Rate of Contraction, represented as the change in force over the change in time (Delta Force / Delta Time). The vertical axis ranges from 0 to 1200. The W T group (gray bar) shows a mean rate of approximately 900, while the Ttn Delta A164-167 group (blue bar) is significantly slower, with a mean rate of approximately 680. This decrease is marked with two asterisks, indicating a high level of statistical significance. Panel D (Max Rate Rel.): This graph displays the Maximum Rate of Relaxation (Delta Force / Delta Time). The vertical axis represents negative values ranging from 0 to minus 250. The W T group averages roughly minus 195, while the mutant group averages roughly minus 175. The bracket labeled ns indicates that there is no statistically significant difference in the speed of muscle relaxation between the two genotypes. Panel E (Fatigue Index): This graph illustrates the Fatigue Index, expressed as a Ratio on the vertical axis ranging from 0.00 to 0.25. A higher ratio indicates a greater loss of force over time (increased fatigue). The W T group shows a mean ratio of approximately 0.10, whereas the Ttn Delta A164-167 group exhibits a significantly higher mean ratio of approximately 0.16. This significant increase in fatigue is marked with two asterisks, showing that the mutant muscles tire more easily than their wild-type counterparts. All values are approximate.
Intact EDL studies. (A) Force–frequency relationship of intact EDL muscle with PCSA measurement inset. The force–frequency curves were fit with a Hill equation, and statistical significance for curve fit was determined by an extra sum-of-squares F test. Statistical significance for each frequency was determined by two-way repeated-measures ANOVA with Sidak’s multiple comparisons test (significance denoted by asterisks on plot), and for PCSA by an unpaired t test. (B) F50, or the frequency at which 50% of maximal force is produced, for EDL muscle. (C) Maximal rate of contraction (maximum dx/dt) during a twitch (1 Hz) stimulation of intact EDL muscles. (D) Maximal rate of relaxation (minimum dx/dt) during a twitch (1 Hz) stimulation of intact EDL muscles. (E) Fatigue index, a ratio of the average force produced by the last five stimulations to the average force produced by the first five stimulations of a 75-stimulation fatigue protocol on intact EDL muscles. ns, p ≥ 0.05; **p ≤ 0.01; ***p ≤ 0.001.
Panel A: E D L Force-Frequency Curve: This line graph illustrates the relationship between stimulation frequency and muscle force production in the Extensor Digitorum Longus muscle. The horizontal axis represents the stimulation frequency measured in Hertz, ranging from 0 to 250 Hertz with major increments of 50 Hertz. The vertical axis represents Specific force measured in milliNewtons per square millimeter, ranging from 0 to 350 with increments of 50. A gray line represents the W T (Wild-Type) group, which rises from roughly 40 milliNewtons per square millimeter at low frequencies to a plateau of approximately 275 milliNewtons per square millimeter at 250 Hertz. A blue line represents the Ttn Delta A164-167 mutant group, which starts lower and plateaus significantly lower at roughly 200 milliNewtons per square millimeter. The gap between the two curves is marked with an asterisk at every data point, indicating high statistical significance, with a general curve p-value less than 0.0001. An inset horizontal bar graph shows the P C S A (Physiological Cross-Sectional Area) in square millimeters from 0.0 to 1.5; the blue mutant bar is significantly shorter than the gray W T bar, marked with a single asterisk. Panel B: F 50 Frequency Analysis: This bar graph quantifies the F 50, which is the frequency required to reach 50 percent of the maximum specific force. The vertical axis represents frequency in Hertz, ranging from 0 to 80 with increments of 20. The W T group (gray bar) and the Ttn Delta A164-167 group (blue bar) both reach a mean value of approximately 60 Hertz. Individual data points for both groups are clustered around this mean, and a bracket at the top labeled ns indicates that there is no statistically significant difference in the F 50 values between the two genotypes. Panel C (Max Rate Cont.): This bar graph measures the Maximum Rate of Contraction, represented as the change in force over the change in time (Delta Force / Delta Time). The vertical axis ranges from 0 to 1200. The W T group (gray bar) shows a mean rate of approximately 900, while the Ttn Delta A164-167 group (blue bar) is significantly slower, with a mean rate of approximately 680. This decrease is marked with two asterisks, indicating a high level of statistical significance. Panel D (Max Rate Rel.): This graph displays the Maximum Rate of Relaxation (Delta Force / Delta Time). The vertical axis represents negative values ranging from 0 to minus 250. The W T group averages roughly minus 195, while the mutant group averages roughly minus 175. The bracket labeled ns indicates that there is no statistically significant difference in the speed of muscle relaxation between the two genotypes. Panel E (Fatigue Index): This graph illustrates the Fatigue Index, expressed as a Ratio on the vertical axis ranging from 0.00 to 0.25. A higher ratio indicates a greater loss of force over time (increased fatigue). The W T group shows a mean ratio of approximately 0.10, whereas the Ttn Delta A164-167 group exhibits a significantly higher mean ratio of approximately 0.16. This significant increase in fatigue is marked with two asterisks, showing that the mutant muscles tire more easily than their wild-type counterparts. All values are approximate.
Intact EDL studies. (A) Force–frequency relationship of intact EDL muscle with PCSA measurement inset. The force–frequency curves were fit with a Hill equation, and statistical significance for curve fit was determined by an extra sum-of-squares F test. Statistical significance for each frequency was determined by two-way repeated-measures ANOVA with Sidak’s multiple comparisons test (significance denoted by asterisks on plot), and for PCSA by an unpaired t test. (B) F50, or the frequency at which 50% of maximal force is produced, for EDL muscle. (C) Maximal rate of contraction (maximum dx/dt) during a twitch (1 Hz) stimulation of intact EDL muscles. (D) Maximal rate of relaxation (minimum dx/dt) during a twitch (1 Hz) stimulation of intact EDL muscles. (E) Fatigue index, a ratio of the average force produced by the last five stimulations to the average force produced by the first five stimulations of a 75-stimulation fatigue protocol on intact EDL muscles. ns, p ≥ 0.05; **p ≤ 0.01; ***p ≤ 0.001.
Panel A: Muscle Cross-Section Histology. This panel contains two fluorescence microscopy images of muscle tissue cross-sections, comparing W T (Wild Type) at the top and Ttn Delta A164-167 at the bottom. The images show muscle fibers outlined in red, with nuclei shown as small cyan/blue dots. In the W T section, almost all nuclei are located at the periphery of the fibers, which is the normal physiological state. A 50 micrometer scale bar is visible in the lower right corner. The Ttn Delta A164-167 section shows similar fiber organization, but a small white box highlights a specific area for magnification. The magnified inset (bottom right) uses a white arrow to point to a central nucleus𠅊 nucleus located in the middle of a muscle fiber rather than at the edge, which can be a sign of muscle regeneration or pathology. Panel B: Quantification of Fibers with Central Nuclei. This bar graph quantifies the observations from the histology in Panel A. The vertical axis represents the percentage of fibers containing central nuclei, with a range from 0 to 4 and increments of 1. The horizontal axis compares two groups: W T (represented by a gray bar) and Ttn Delta A164-167 (represented by a blue bar). The W T group shows a mean value of less than 1 percent, while the Ttn Delta A164-167 group shows a slightly higher mean of approximately 2 percent. Individual data points are plotted as dots over the bars, and error bars indicate the standard deviation. A bracket above the two bars is labeled with ns (not significant), indicating that despite the slight visual increase, there is no statistically significant difference in central nuclei between the two groups. All values are approximate.
Analysis of centrally located nuclei in EDL muscle. (A) Representative images of a WT (top) and TtnΔA164–167 (bottom) EDL cross-section stained with anti-laminin antibody (cell borders) and DAPI (nuclei). The arrow in the inset of the TtnΔA164–167 panel indicates a centrally located nucleus. (B) Percentage of EDL fibers containing central nuclei. Statistical significance was determined by an unpaired t test. Three animals from each genotype were used, with 333–697 fibers analyzed per animal.
Panel A: Muscle Cross-Section Histology. This panel contains two fluorescence microscopy images of muscle tissue cross-sections, comparing W T (Wild Type) at the top and Ttn Delta A164-167 at the bottom. The images show muscle fibers outlined in red, with nuclei shown as small cyan/blue dots. In the W T section, almost all nuclei are located at the periphery of the fibers, which is the normal physiological state. A 50 micrometer scale bar is visible in the lower right corner. The Ttn Delta A164-167 section shows similar fiber organization, but a small white box highlights a specific area for magnification. The magnified inset (bottom right) uses a white arrow to point to a central nucleus𠅊 nucleus located in the middle of a muscle fiber rather than at the edge, which can be a sign of muscle regeneration or pathology. Panel B: Quantification of Fibers with Central Nuclei. This bar graph quantifies the observations from the histology in Panel A. The vertical axis represents the percentage of fibers containing central nuclei, with a range from 0 to 4 and increments of 1. The horizontal axis compares two groups: W T (represented by a gray bar) and Ttn Delta A164-167 (represented by a blue bar). The W T group shows a mean value of less than 1 percent, while the Ttn Delta A164-167 group shows a slightly higher mean of approximately 2 percent. Individual data points are plotted as dots over the bars, and error bars indicate the standard deviation. A bracket above the two bars is labeled with ns (not significant), indicating that despite the slight visual increase, there is no statistically significant difference in central nuclei between the two groups. All values are approximate.
Analysis of centrally located nuclei in EDL muscle. (A) Representative images of a WT (top) and TtnΔA164–167 (bottom) EDL cross-section stained with anti-laminin antibody (cell borders) and DAPI (nuclei). The arrow in the inset of the TtnΔA164–167 panel indicates a centrally located nucleus. (B) Percentage of EDL fibers containing central nuclei. Statistical significance was determined by an unpaired t test. Three animals from each genotype were used, with 333–697 fibers analyzed per animal.
To determine whether the functional effects measured in the EDL are consistent across skeletal muscles, we tested soleus function by whole-muscle mechanics. In contrast to our findings in the EDL muscle, the TtnΔA164–167 soleus muscles generate force at levels similar to WT, with no significant differences as determined by two-way ANOVA (Fig. S4). However, the force–frequency curve fit was statistically different between WT and TtnΔA164–167. Therefore, the slightly lower forces produced by the TtnΔA164–167 when stimulated at higher frequencies (60 Hz and above) are relevant and suggest that, although very minor, soleus function is impacted by the deletion of domains A164–167. As with the EDL muscles, we measured MyHC content of the mechanically tested soleus muscles and found a more drastic fiber-type switch between WT and TtnΔA164–167 muscles, with type I fiber content increasing by ∼45% in TtnΔA164–167 soleus relative to WT.
Panel A: Soleus Force-Frequency Curve: This line graph details the relationship between the rate of muscle stimulation and the resulting specific force production in the Soleus muscle. The horizontal axis represents frequency in Hertz, ranging from 0 to 150 Hertz with major increments of 50 Hertz. The vertical axis represents Specific force measured in milliNewtons per square millimeter, ranging from 0 to 350 with increments of 50. The gray line (W T) and blue line (Ttn Delta A164-167) start at a baseline of approximately 40 milliNewtons per square millimeter and rise sharply until 50 Hertz. Beyond 50 Hertz, the curves begin to plateau; the W T group reaches a maximum of approximately 250 milliNewtons per square millimeter, while the mutant group is slightly lower, plateauing at roughly 230 milliNewtons per square millimeter. The difference between these two curves is statistically significant with a p-value of 0.0031. P C S A Inset: A horizontal bar graph inset compares the Physiological Cross-Sectional Area in square millimeters on a scale from 0.0 to 1.0. Both the gray WT bar and blue mutant bar reach nearly identical lengths of approximately 0.85 square millimeters, and the bracket labeled ns indicates no statistical difference in muscle size between the groups. Panel B: F 50 Frequency Analysis: This bar graph quantifies the frequency required to achieve 50 percent of the maximum specific force. The vertical axis represents frequency in Hertz, ranging from 0 to 30 with increments of 10. The gray W T bar and the blue mutant bar both reach a mean value of approximately 22 Hertz. Individual data points are plotted over the bars, showing similar distributions for both genotypes. The bracket at the top is labeled ns, confirming that there is no statistically significant difference in the force-frequency sensitivity of the Soleus muscle between the two groups. Panel C: Max Rate Contraction: This bar graph displays the Maximum Rate of Contraction, measured as the change in force over time (Delta Force / Delta Time). The vertical axis ranges from 0 to 400. The W T group (gray bar) averages approximately 310, while the Ttn Delta A164-167 group (blue bar) averages approximately 270. Individual data points are scattered over both bars, and the bracket at the top is labeled ns, indicating that there is no statistically significant difference in the speed of contraction for the Soleus muscle between the two genotypes. Panel D: Max Rate Relaxation. This bar graph illustrates the Maximum Rate of Relaxation (Delta Force / Delta Time). The vertical axis represents negative values ranging from 0 to minus 80. Both the W T group (gray bar) and the mutant group (blue bar) show a nearly identical mean value of approximately minus 50. A bracket labeled ns confirms that the mutation does not significantly impact the rate at which the Soleus muscle relaxes. Panel E: Fatigue Index. This bar graph quantifies the Fatigue Index, shown as a Ratio on the vertical axis ranging from 0.0 to 0.8. The WT group (gray bar) shows a mean ratio of approximately 0.45, while the Ttn Delta A164-167 group (blue bar) exhibits a significantly higher mean ratio of approximately 0.62. This significant increase in susceptibility to fatigue is marked with a single asterisk, indicating that the mutant Soleus muscle tires more quickly than the wild-type. Panel F: Soleus My H C Isoform Analysis. This panel provides a protein-level analysis of Myosin Heavy Chain (My H C) isoforms in the Soleus. At the top, a protein gel blot shows separated bands corresponding to different fiber types: I I A, I I X, I I B, and I. Below, a stacked bar graph quantifies these isoforms as a Percentage on a scale from 0 to 100. In the Ttn Delta A164-167 group, there is a dramatic shift: Type I increases to approximately 60 percent, while Type 2 A decreases to roughly 25 percent and Type 8 decreases to roughly 15 percent. These significant changes are marked with triple and quadruple asterisks, highlighting a major shift toward a slower fiber-type profile in the mutant Soleus. All values are approximate.Soleus function in the TtnΔA164–167model. (A) Force–frequency relationship of intact soleus muscle with PCSA measurement inset. The force–frequency curves were fit with a Hill equation, and statistical significance for curve fit was determined by an extra sum-of-squares F test. Statistical significance for each frequency was determined by two-way ANOVA (no significance), and for PCSA by an unpaired t test. (B) F50, or the frequency at which 50% of maximal force is produced, for soleus muscle. (C) Maximal rate of contraction (maximum dx/dt) during twitch (1 Hz) stimulations of intact soleus muscles. (D) Maximal rate of relaxation (minimum dx/dt) during twitch (1 Hz) stimulations of intact soleus muscles. (E) Fatigue index, a ratio of the average force produced by the last five stimulations to the average force produced by the first five stimulations of a 75-stimulation fatigue protocol on intact soleus muscles. Statistical significance for B–E was determined by an unpaired t test. 5–6 mice of each genotype were used. (F) MyHC ratios in soleus muscle were determined by SDS-PAGE. Statistical significance was determined by multiple t tests (WT vs. TtnΔA164–167 by fiber type). 5–6 mice of each genotype were used. ns, p ≥ 0.05; *p ≤ 0.05. Source data are available for this figure: SourceData FS4.
Panel A: Soleus Force-Frequency Curve: This line graph details the relationship between the rate of muscle stimulation and the resulting specific force production in the Soleus muscle. The horizontal axis represents frequency in Hertz, ranging from 0 to 150 Hertz with major increments of 50 Hertz. The vertical axis represents Specific force measured in milliNewtons per square millimeter, ranging from 0 to 350 with increments of 50. The gray line (W T) and blue line (Ttn Delta A164-167) start at a baseline of approximately 40 milliNewtons per square millimeter and rise sharply until 50 Hertz. Beyond 50 Hertz, the curves begin to plateau; the W T group reaches a maximum of approximately 250 milliNewtons per square millimeter, while the mutant group is slightly lower, plateauing at roughly 230 milliNewtons per square millimeter. The difference between these two curves is statistically significant with a p-value of 0.0031. P C S A Inset: A horizontal bar graph inset compares the Physiological Cross-Sectional Area in square millimeters on a scale from 0.0 to 1.0. Both the gray WT bar and blue mutant bar reach nearly identical lengths of approximately 0.85 square millimeters, and the bracket labeled ns indicates no statistical difference in muscle size between the groups. Panel B: F 50 Frequency Analysis: This bar graph quantifies the frequency required to achieve 50 percent of the maximum specific force. The vertical axis represents frequency in Hertz, ranging from 0 to 30 with increments of 10. The gray W T bar and the blue mutant bar both reach a mean value of approximately 22 Hertz. Individual data points are plotted over the bars, showing similar distributions for both genotypes. The bracket at the top is labeled ns, confirming that there is no statistically significant difference in the force-frequency sensitivity of the Soleus muscle between the two groups. Panel C: Max Rate Contraction: This bar graph displays the Maximum Rate of Contraction, measured as the change in force over time (Delta Force / Delta Time). The vertical axis ranges from 0 to 400. The W T group (gray bar) averages approximately 310, while the Ttn Delta A164-167 group (blue bar) averages approximately 270. Individual data points are scattered over both bars, and the bracket at the top is labeled ns, indicating that there is no statistically significant difference in the speed of contraction for the Soleus muscle between the two genotypes. Panel D: Max Rate Relaxation. This bar graph illustrates the Maximum Rate of Relaxation (Delta Force / Delta Time). The vertical axis represents negative values ranging from 0 to minus 80. Both the W T group (gray bar) and the mutant group (blue bar) show a nearly identical mean value of approximately minus 50. A bracket labeled ns confirms that the mutation does not significantly impact the rate at which the Soleus muscle relaxes. Panel E: Fatigue Index. This bar graph quantifies the Fatigue Index, shown as a Ratio on the vertical axis ranging from 0.0 to 0.8. The WT group (gray bar) shows a mean ratio of approximately 0.45, while the Ttn Delta A164-167 group (blue bar) exhibits a significantly higher mean ratio of approximately 0.62. This significant increase in susceptibility to fatigue is marked with a single asterisk, indicating that the mutant Soleus muscle tires more quickly than the wild-type. Panel F: Soleus My H C Isoform Analysis. This panel provides a protein-level analysis of Myosin Heavy Chain (My H C) isoforms in the Soleus. At the top, a protein gel blot shows separated bands corresponding to different fiber types: I I A, I I X, I I B, and I. Below, a stacked bar graph quantifies these isoforms as a Percentage on a scale from 0 to 100. In the Ttn Delta A164-167 group, there is a dramatic shift: Type I increases to approximately 60 percent, while Type 2 A decreases to roughly 25 percent and Type 8 decreases to roughly 15 percent. These significant changes are marked with triple and quadruple asterisks, highlighting a major shift toward a slower fiber-type profile in the mutant Soleus. All values are approximate.Soleus function in the TtnΔA164–167model. (A) Force–frequency relationship of intact soleus muscle with PCSA measurement inset. The force–frequency curves were fit with a Hill equation, and statistical significance for curve fit was determined by an extra sum-of-squares F test. Statistical significance for each frequency was determined by two-way ANOVA (no significance), and for PCSA by an unpaired t test. (B) F50, or the frequency at which 50% of maximal force is produced, for soleus muscle. (C) Maximal rate of contraction (maximum dx/dt) during twitch (1 Hz) stimulations of intact soleus muscles. (D) Maximal rate of relaxation (minimum dx/dt) during twitch (1 Hz) stimulations of intact soleus muscles. (E) Fatigue index, a ratio of the average force produced by the last five stimulations to the average force produced by the first five stimulations of a 75-stimulation fatigue protocol on intact soleus muscles. Statistical significance for B–E was determined by an unpaired t test. 5–6 mice of each genotype were used. (F) MyHC ratios in soleus muscle were determined by SDS-PAGE. Statistical significance was determined by multiple t tests (WT vs. TtnΔA164–167 by fiber type). 5–6 mice of each genotype were used. ns, p ≥ 0.05; *p ≤ 0.05. Source data are available for this figure: SourceData FS4.
Cardiac function
Echocardiography showed that systolic function, as indicated by both fractional shortening and ejection fraction, was normal in TtnΔA164–167 mice (Fig. 6 A and Table S2). However, several parameters suggest the presence of mild changes to diastolic function. Specifically, isovolumic relaxation time (normalized to RR interval) and myocardial performance index showed strong increasing trends (P = 0.072 and P = 0.0824, respectively) in TtnΔA164–167 mice, suggesting a tendency toward delayed relaxation. Mitral valve E-wave deceleration time, which correlates inversely with myocardial stiffness, was significantly decreased by 23%. Mitral valve E/A ratio trended higher in TtnΔA164–167 mice (P = 0.0789), driven by a trending decrease in A-wave velocity. Collectively, these findings suggest potential early-stage diastolic filling impairment (Mishra et al., 2007; Mandinov et al., 2000) (Fig. 6 A). In line with the increased LV tissue weights of TtnΔA164–167 mice, we found a trending increase in LV chamber volume during both systole and diastole (P = 0.130 and P = 0.135, respectively) (Table S2). Although LV volume was slightly larger in TtnΔA164–167 mice, the eccentricity index remained normal, suggesting enlargement of the LV without true dilation. Upon dissection and weighing of the chambers, we found significant increases in the mass of all cardiac chambers of both male and female TtnΔA164–167 mice. LV mass increased by 17%, RV mass increased by 21%, and combined atrial mass increased by 45% compared with WT mice (Fig. 6 B). Thus, despite having preserved systolic function, TtnΔA164–167 mice exhibit signs of mildly impaired diastolic filling and remodeling.
Panel A has six bar graphs: In Fractional Shortening, the vertical axis represents Percent (percentage) from 0 to 40 in increments of 10. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 23 percent, and Ttn Delta A164-167 is at 22 percent. A bracket labeled ns indicates no significant difference. In I V R T over R R Interval: The vertical axis represents metres per second from 0 to 150 in increments of 50. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 78 metres per second, and Ttn Delta A164-167 is at 91 metres per second. A bracket with a p-value of 0.0782 indicates no statistical significance. In M P I: The vertical axis represents arbitrary units from 0.0 to 0.6 in increments of 0.2. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 0.41 a.u., and Ttn Delta A164-167 is at 0.46 a.u. A bracket with a p-value of 0.0824 indicates no statistical significance. In M V E Decel. Time: The vertical axis represents milliseconds from 0 to 50 in increments of 10. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 31 milliseconds, and Ttn Delta A164-167 is at 24 milliseconds. A bracket labeled with two asterisks indicates a significant difference. In M V E over A: The vertical axis represents the Ratio from 0.0 to 2.5 in increments of 0.5. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 1.2, and Ttn Delta A164-167 is at 1.4. A bracket with a p-value of 0.0789 indicates no statistical significance. In M V A wave: The vertical axis represents millimeters per second from 0 to 800 in increments of 200. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 580 millimeters per second, and Ttn Delta A164-167 is at 490 millimeters per second. A bracket with a p-value of 0.1036 indicates no statistical significance. Panel B has four bar graphs: In Whole Heart: The vertical axis represents H W over B W (milligrams per gram) from 0 to 8 in increments of 2. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 4.8 milligrams per gram, and Ttn Delta A164-167 is at 5.6 milligrams per gram. A bracket with two asterisks indicates a significant difference. In Left Ventricle: The vertical axis represents L V weight over B W (milligrams per gram) from 0 to 5 in increments of 1. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 3.1 milligrams per gram, and Ttn Delta A164-167 is at 3.7 milligrams per gram. A bracket with four asterisks indicates a highly significant difference. In the Right Ventricle: The vertical axis represents R V weight over B W (milligrams per gram) from 0.0 to 2.0 in increments of 0.5. The horizontal axis represents W T and Ttn Delta A164-167. WT is at 0.95 milligrams per gram, and Ttn Delta A164-167 is at 1.15 milligrams per gram. A bracket with two asterisks indicates a significant difference. In Atria: The vertical axis represents Atrial weight over B W (milligrams per gram) from 0.0 to 0.6 in increments of 0.2. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 0.26 milligrams per gram, and Ttn Delta A164-167 is at 0.38 milligrams per gram. A bracket with three asterisks indicates a significant difference. Panel C consists of two side-by-side micrographs of cardiac tissue. W T histology shows a microscopic view of heart tissue sectioned longitudinally. Muscle fibers appear as organized, pink-stained parallel structures with dark purple nuclei. A scale bar at the bottom right indicates 100 micrometers. Ttn Delta A164-167 Histology shows a microscopic view of heart tissue with fibers running diagonally. The tissue displays similar striated pink muscle fibers and purple nuclei, appearing slightly denser than the W T section. All values are approximate.
Cardiac function and morphology. (A) Fractional shortening, isovolumic relaxation time normalized to RR time interval (IVRT/RR interval), myocardial performance index (MPI), mitral valve E-wave deceleration time (MV E decel. time), mitral valve E/A ratio, and mitral valve A-wave, as measured by echocardiography. 9 WT and 12 TtnΔA164–16 mice were used in echocardiography studies. (B) Muscle weight-to-BW ratio for the whole heart, left ventricle, right ventricle, and combined atrial weights. 12–16 WT and 13–17 TtnΔA164–167 mice were used. Statistical significance for A and B was determined by an unpaired t test. (C) Representative images of WT (left) and TtnΔA164–167 (right) Masson’s trichrome-stained heart sections. Three mice of each genotype were used (one representative image from each genotype is shown). BW, body weight. ns, p≥0.05; **p ≤ 0.01; ***p ≤ 0.001; ****p ≤ 0.0001.
Panel A has six bar graphs: In Fractional Shortening, the vertical axis represents Percent (percentage) from 0 to 40 in increments of 10. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 23 percent, and Ttn Delta A164-167 is at 22 percent. A bracket labeled ns indicates no significant difference. In I V R T over R R Interval: The vertical axis represents metres per second from 0 to 150 in increments of 50. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 78 metres per second, and Ttn Delta A164-167 is at 91 metres per second. A bracket with a p-value of 0.0782 indicates no statistical significance. In M P I: The vertical axis represents arbitrary units from 0.0 to 0.6 in increments of 0.2. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 0.41 a.u., and Ttn Delta A164-167 is at 0.46 a.u. A bracket with a p-value of 0.0824 indicates no statistical significance. In M V E Decel. Time: The vertical axis represents milliseconds from 0 to 50 in increments of 10. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 31 milliseconds, and Ttn Delta A164-167 is at 24 milliseconds. A bracket labeled with two asterisks indicates a significant difference. In M V E over A: The vertical axis represents the Ratio from 0.0 to 2.5 in increments of 0.5. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 1.2, and Ttn Delta A164-167 is at 1.4. A bracket with a p-value of 0.0789 indicates no statistical significance. In M V A wave: The vertical axis represents millimeters per second from 0 to 800 in increments of 200. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 580 millimeters per second, and Ttn Delta A164-167 is at 490 millimeters per second. A bracket with a p-value of 0.1036 indicates no statistical significance. Panel B has four bar graphs: In Whole Heart: The vertical axis represents H W over B W (milligrams per gram) from 0 to 8 in increments of 2. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 4.8 milligrams per gram, and Ttn Delta A164-167 is at 5.6 milligrams per gram. A bracket with two asterisks indicates a significant difference. In Left Ventricle: The vertical axis represents L V weight over B W (milligrams per gram) from 0 to 5 in increments of 1. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 3.1 milligrams per gram, and Ttn Delta A164-167 is at 3.7 milligrams per gram. A bracket with four asterisks indicates a highly significant difference. In the Right Ventricle: The vertical axis represents R V weight over B W (milligrams per gram) from 0.0 to 2.0 in increments of 0.5. The horizontal axis represents W T and Ttn Delta A164-167. WT is at 0.95 milligrams per gram, and Ttn Delta A164-167 is at 1.15 milligrams per gram. A bracket with two asterisks indicates a significant difference. In Atria: The vertical axis represents Atrial weight over B W (milligrams per gram) from 0.0 to 0.6 in increments of 0.2. The horizontal axis represents W T and Ttn Delta A164-167. W T is at 0.26 milligrams per gram, and Ttn Delta A164-167 is at 0.38 milligrams per gram. A bracket with three asterisks indicates a significant difference. Panel C consists of two side-by-side micrographs of cardiac tissue. W T histology shows a microscopic view of heart tissue sectioned longitudinally. Muscle fibers appear as organized, pink-stained parallel structures with dark purple nuclei. A scale bar at the bottom right indicates 100 micrometers. Ttn Delta A164-167 Histology shows a microscopic view of heart tissue with fibers running diagonally. The tissue displays similar striated pink muscle fibers and purple nuclei, appearing slightly denser than the W T section. All values are approximate.
Cardiac function and morphology. (A) Fractional shortening, isovolumic relaxation time normalized to RR time interval (IVRT/RR interval), myocardial performance index (MPI), mitral valve E-wave deceleration time (MV E decel. time), mitral valve E/A ratio, and mitral valve A-wave, as measured by echocardiography. 9 WT and 12 TtnΔA164–16 mice were used in echocardiography studies. (B) Muscle weight-to-BW ratio for the whole heart, left ventricle, right ventricle, and combined atrial weights. 12–16 WT and 13–17 TtnΔA164–167 mice were used. Statistical significance for A and B was determined by an unpaired t test. (C) Representative images of WT (left) and TtnΔA164–167 (right) Masson’s trichrome-stained heart sections. Three mice of each genotype were used (one representative image from each genotype is shown). BW, body weight. ns, p≥0.05; **p ≤ 0.01; ***p ≤ 0.001; ****p ≤ 0.0001.
To determine whether myocardial fibrosis was a contributing factor to the organ-level diastolic functional changes detected by echocardiography, we examined TtnΔA164–167 hearts histologically. Qualitative assessment of Masson’s trichrome-stained WT and TtnΔA164–167 hearts found no overt fibrosis (Fig. 6 C), indicating this is not a driving factor of the functional changes observed at 3 mo of age.
Titin layout in the A-band
We mapped titin’s position in the thick filament using immunolabeling. The four-domain deletion of domains A164–167 is expected to cause a 16-nm length reduction in titin, as each Ig-like and FnIII-like domain spans ∼4 nm when folded (Trinick et al., 1984; Pfuhl and Pastore, 1995; Dutta et al., 2023). Four antibodies that label titin epitopes along the A-band segment were chosen to determine titin’s position on either side of the deleted domains (see Fig. 7 A for details). IEM and SR-SIM were used to visualize antibody-labeled muscle sections.
A linear schematic of a protein structure, labeled A, is organized into five distinct regions from left to right: M-band, P-zone, C-zone (x 11), D-zone (x 6), and I over A junction. The structure consists of a sequence of oval-shaped domains color-coded in blue, purple, and white. Starting from the left, the M-band region features blue and purple domains, with an arrow pointing to a segment labeled M8-M10 C-terminus. Moving right, the P-zone contains white and purple domains, with an arrow indicating the A168-170 P-zone over M-band transition. The C-zone (x 11) follows with a repeating pattern of white and purple domains, where an arrow identifies the A77-78 C-zone S R 4 location. The D-zone (x 6) continues this pattern of white and purple ovals. Finally, the I over A junction on the far right includes white and purple domains, marked by two arrows pointing to Ti102 Edge of A-band and M I R. The second image, labeled B, compares structural data between wild-type and Ttn Delta A164-167 mutant cardiac tissue. Intensity Profiles: On the left, two grayscale electron micrographs of sarcomeres are shown for W T and the mutant, each paired with an intensity line graph below. The horizontal axis represents Distance (nanometers) from 0 to over 2000, in increments of 1000. The vertical axis represents Gray Value from 50 to 200, in increments of 50. Distinct peaks labeled Z appear at the ends (Z-discs), and a double peak marked by a black arrow appears in the center, representing the M-band. M8-M10 Localization Graph: On the far right, a histogram titled M8-M10 plots the frequency of specific domain distances from the M-band center. The horizontal axis represents the Distance to the middle of the M-band (nanometers) from 0 to 200 in increments of 50. The vertical axis represents Count from 0 to 80 in increments of 20. The W T data (gray) shows a peak at 41 nanometers, while the Ttn Delta A164-167 data (blue) shows a peak shifted slightly to 43 nanometers. The third image, labeled C illustrates the structural analysis of the A168-170 transition region, comparing Wild Type (W T) and Ttn Delta A164-167 mutant cardiac tissue. The panel includes two sets of grayscale electron micrographs of sarcomeres with corresponding intensity line graphs below them. In these graphs, the vertical axis represents Gray Value from 50 to 250 in increments of 50, and the horizontal axis represents Distance (nanometers) from 0 to over 2000, in increment of 1000. High peaks labeled Z identify the Z-discs at the boundaries. In the W T profile, the central M-band region displays two distinct peaks labeled alpha and beta. In the Ttn Delta A164-167 profile, the beta peak is absent, leaving only the alpha peak visible. To the right, a histogram titled A168-170 plots the Distance to the middle of M-band (nanometers) from 40 to 300 on the horizontal axis against Count from 0 to 25 on the vertical axis. The W T data shows two gray peaks: alpha at 87 nanometers and beta at 125 nanometers. The mutant data (blue) displays a single peak for alpha, which is shifted to 70 nanometers. The fourth image, labeled D, presents a structural analysis of the A77-78 titin domain localization using fluorescence microscopy and distance mapping. On the left, a multi-channel fluorescence image displays green vertical bands for alpha-actinin at the Z-discs and red bands for the A77-78 domain. Below this image, an intensity profile graph plots Distance (nanometers) from 0 to 2500 on the horizontal axis against two vertical axes: A77-78 intensity in red (0 to 25,000) and alpha-actinin intensity in green (0.0 to 1.0). The graph shows two prominent green peaks labeled Z at the outer boundaries and two sharp red peaks positioned symmetrically between them. On the right, a histogram titled A77-78 plots the Distance to the middle of M-band (nanometers) from 0 to 1000 on the horizontal axis against Count from 0 to 100 on the vertical axis. The Wild Type (W T) data, shown in gray, peaks at 443 nanometers, while the Ttn Delta A164-167 mutant data, shown in blue, peaks at a significantly shorter distance of 407 nanometers. The fifth image, labeled E presents a structural analysis of the Ti102 over M I R titin domain localization using fluorescence microscopy and distance mapping. On the left, a fluorescence image shows red vertical bands representing the M I R domain flanked by green bands representing the alpha-actinin at the Z-discs. Below this image, an intensity profile graph plots Distance (nanometers) from 0 to 2500 on the horizontal axis against two vertical axes: M I R intensity in red from 0 to 50,000 and alpha-actinin intensity in green from 0.0 to 1.0. The graph displays two green peaks labeled Z at the boundaries and two tall, sharp red peaks located toward the interior of the sarcomere. On the right, a histogram titled Ti102 over M I R plots the Distance to the middle of the M-band (nanometers) from 0 to 1000 on the horizontal axis against Count from 0 to 150 on the vertical axis. The Wild Type (W T) data, shown in gray, peaks at 776 nanometers, whereas the Ttn Delta A164-167 mutant data, shown in blue, shows a significant leftward shift with a peak at 736 nanometers. All values are approximate.
Mapping titin’s A-band epitopes in Ttn ΔA164–167 cardiac muscle. (A) Schematic of titin’s A-band (M-band on left) with summary of epitopes used to map titin’s arrangement in the A-band. (B) Representative immunoelectron micrograph of WT (left) and TtnΔA164–167 (right) sarcomeres labeled with the M8–M10 antibody to mark the C terminus of titin. The plot profiles are below the sarcomeres; the Z-disks of each sarcomere are indicated, and arrows indicate the peak on the plot profile corresponding to the epitope label in the image on the right half of the sarcomere. The frequency distribution of the measured distance of the epitope from the middle of the M-band is plotted to the right, with the average epitope distance listed on the plot. N = 2 mice/genotype, with n = 132–168 sarcomeres measured. (C) Representative immunoelectron micrographs of WT (left) and TtnΔA164–167 (right) sarcomeres labeled with A168–170 antibody to mark the P-zone-to-M-band transition. The plot profiles are below the sarcomeres; the Z-disks of each sarcomere are indicated, and arrows indicate the peak on the plot profile corresponding to the epitope label in the image on the right half of the sarcomere. The frequency distribution of the measured distance of the epitope from the middle of the M-band is plotted to the right, with the average epitope distance listed on the plot. N = 2 mice/genotype, n = 66–91 sarcomeres measured. (D) Representative super-resolution optical microscopy image of a sarcomere labeled with A77–A78 antibody to mark titin’s C-zone super-repeat 4 (Z-disks marked by α-actinin), with fluorescence plot profile below (Z-disks indicated in the plot profile). The frequency distribution of distance measurements is plotted to the right. The average epitope distance is listed on the plot. N = 3 mice/genotype, n = 163–382 sarcomeres measured. (E) Representative super-resolution optical microscopy image of a sarcomere labeled with Ti102 or MIR antibody to mark the edge of the A-band (Z-disks marked by α-actinin), with fluorescence plot profile below (Z-disks indicated in the plot profile). The frequency distribution of distance measurements is plotted to the right. The average epitope distance is listed on the plot. N = 3 mice/genotype, n = 425–509 sarcomeres measured. The average distance, standard deviation, difference between genotypes, and statistical significance are detailed in Table 1.
A linear schematic of a protein structure, labeled A, is organized into five distinct regions from left to right: M-band, P-zone, C-zone (x 11), D-zone (x 6), and I over A junction. The structure consists of a sequence of oval-shaped domains color-coded in blue, purple, and white. Starting from the left, the M-band region features blue and purple domains, with an arrow pointing to a segment labeled M8-M10 C-terminus. Moving right, the P-zone contains white and purple domains, with an arrow indicating the A168-170 P-zone over M-band transition. The C-zone (x 11) follows with a repeating pattern of white and purple domains, where an arrow identifies the A77-78 C-zone S R 4 location. The D-zone (x 6) continues this pattern of white and purple ovals. Finally, the I over A junction on the far right includes white and purple domains, marked by two arrows pointing to Ti102 Edge of A-band and M I R. The second image, labeled B, compares structural data between wild-type and Ttn Delta A164-167 mutant cardiac tissue. Intensity Profiles: On the left, two grayscale electron micrographs of sarcomeres are shown for W T and the mutant, each paired with an intensity line graph below. The horizontal axis represents Distance (nanometers) from 0 to over 2000, in increments of 1000. The vertical axis represents Gray Value from 50 to 200, in increments of 50. Distinct peaks labeled Z appear at the ends (Z-discs), and a double peak marked by a black arrow appears in the center, representing the M-band. M8-M10 Localization Graph: On the far right, a histogram titled M8-M10 plots the frequency of specific domain distances from the M-band center. The horizontal axis represents the Distance to the middle of the M-band (nanometers) from 0 to 200 in increments of 50. The vertical axis represents Count from 0 to 80 in increments of 20. The W T data (gray) shows a peak at 41 nanometers, while the Ttn Delta A164-167 data (blue) shows a peak shifted slightly to 43 nanometers. The third image, labeled C illustrates the structural analysis of the A168-170 transition region, comparing Wild Type (W T) and Ttn Delta A164-167 mutant cardiac tissue. The panel includes two sets of grayscale electron micrographs of sarcomeres with corresponding intensity line graphs below them. In these graphs, the vertical axis represents Gray Value from 50 to 250 in increments of 50, and the horizontal axis represents Distance (nanometers) from 0 to over 2000, in increment of 1000. High peaks labeled Z identify the Z-discs at the boundaries. In the W T profile, the central M-band region displays two distinct peaks labeled alpha and beta. In the Ttn Delta A164-167 profile, the beta peak is absent, leaving only the alpha peak visible. To the right, a histogram titled A168-170 plots the Distance to the middle of M-band (nanometers) from 40 to 300 on the horizontal axis against Count from 0 to 25 on the vertical axis. The W T data shows two gray peaks: alpha at 87 nanometers and beta at 125 nanometers. The mutant data (blue) displays a single peak for alpha, which is shifted to 70 nanometers. The fourth image, labeled D, presents a structural analysis of the A77-78 titin domain localization using fluorescence microscopy and distance mapping. On the left, a multi-channel fluorescence image displays green vertical bands for alpha-actinin at the Z-discs and red bands for the A77-78 domain. Below this image, an intensity profile graph plots Distance (nanometers) from 0 to 2500 on the horizontal axis against two vertical axes: A77-78 intensity in red (0 to 25,000) and alpha-actinin intensity in green (0.0 to 1.0). The graph shows two prominent green peaks labeled Z at the outer boundaries and two sharp red peaks positioned symmetrically between them. On the right, a histogram titled A77-78 plots the Distance to the middle of M-band (nanometers) from 0 to 1000 on the horizontal axis against Count from 0 to 100 on the vertical axis. The Wild Type (W T) data, shown in gray, peaks at 443 nanometers, while the Ttn Delta A164-167 mutant data, shown in blue, peaks at a significantly shorter distance of 407 nanometers. The fifth image, labeled E presents a structural analysis of the Ti102 over M I R titin domain localization using fluorescence microscopy and distance mapping. On the left, a fluorescence image shows red vertical bands representing the M I R domain flanked by green bands representing the alpha-actinin at the Z-discs. Below this image, an intensity profile graph plots Distance (nanometers) from 0 to 2500 on the horizontal axis against two vertical axes: M I R intensity in red from 0 to 50,000 and alpha-actinin intensity in green from 0.0 to 1.0. The graph displays two green peaks labeled Z at the boundaries and two tall, sharp red peaks located toward the interior of the sarcomere. On the right, a histogram titled Ti102 over M I R plots the Distance to the middle of the M-band (nanometers) from 0 to 1000 on the horizontal axis against Count from 0 to 150 on the vertical axis. The Wild Type (W T) data, shown in gray, peaks at 776 nanometers, whereas the Ttn Delta A164-167 mutant data, shown in blue, shows a significant leftward shift with a peak at 736 nanometers. All values are approximate.
Mapping titin’s A-band epitopes in Ttn ΔA164–167 cardiac muscle. (A) Schematic of titin’s A-band (M-band on left) with summary of epitopes used to map titin’s arrangement in the A-band. (B) Representative immunoelectron micrograph of WT (left) and TtnΔA164–167 (right) sarcomeres labeled with the M8–M10 antibody to mark the C terminus of titin. The plot profiles are below the sarcomeres; the Z-disks of each sarcomere are indicated, and arrows indicate the peak on the plot profile corresponding to the epitope label in the image on the right half of the sarcomere. The frequency distribution of the measured distance of the epitope from the middle of the M-band is plotted to the right, with the average epitope distance listed on the plot. N = 2 mice/genotype, with n = 132–168 sarcomeres measured. (C) Representative immunoelectron micrographs of WT (left) and TtnΔA164–167 (right) sarcomeres labeled with A168–170 antibody to mark the P-zone-to-M-band transition. The plot profiles are below the sarcomeres; the Z-disks of each sarcomere are indicated, and arrows indicate the peak on the plot profile corresponding to the epitope label in the image on the right half of the sarcomere. The frequency distribution of the measured distance of the epitope from the middle of the M-band is plotted to the right, with the average epitope distance listed on the plot. N = 2 mice/genotype, n = 66–91 sarcomeres measured. (D) Representative super-resolution optical microscopy image of a sarcomere labeled with A77–A78 antibody to mark titin’s C-zone super-repeat 4 (Z-disks marked by α-actinin), with fluorescence plot profile below (Z-disks indicated in the plot profile). The frequency distribution of distance measurements is plotted to the right. The average epitope distance is listed on the plot. N = 3 mice/genotype, n = 163–382 sarcomeres measured. (E) Representative super-resolution optical microscopy image of a sarcomere labeled with Ti102 or MIR antibody to mark the edge of the A-band (Z-disks marked by α-actinin), with fluorescence plot profile below (Z-disks indicated in the plot profile). The frequency distribution of distance measurements is plotted to the right. The average epitope distance is listed on the plot. N = 3 mice/genotype, n = 425–509 sarcomeres measured. The average distance, standard deviation, difference between genotypes, and statistical significance are detailed in Table 1.
We first probed the location of titin’s C-terminal M-band domains using the M8–M10 antibody (Fig. 7 B). This epitope measured an average of 41 nm from the center of the sarcomere in WT LV sarcomeres. In TtnΔA164–167 LV sarcomeres, localization of this epitope was normal with an average distance of 43 nm from the sarcomere center, indicating that titin’s M-band likely incorporates normally in TtnΔA164–167 cardiac sarcomeres (Fig. 7 B and Table 1).
Summary of titin and cMyBP-C epitope distances
| Epitope . | WT distance (nm) . | TtnΔA164–167 distance (nm) . | Difference (nm) . | P value . | Significance . |
|---|---|---|---|---|---|
| M8–M10 | 41 ± 5 | 43 ± 6 | 2 | 0.5223 | ns |
| A168–170 α | 87 ± 6 | 70 ± 11 | 17 | 0.0473 | * |
| A168–170 β | 125 ± 6 | - | - | - | |
| cMyBP-C 1 | 165 ± 8 | 126 ± 13 | 39 | 0.0052 | ** |
| A77–78 | 443 ± 21 | 407 ± 21 | 37 | 0.0032 | ** |
| cMyBP-C 9 | 509 ± 11 | 463 ± 14 | 46 | 0.0057 | ** |
| Ti102 | 776 ± 33 | 736 ± 27 | 40 | 0.0097 | ** |
| Epitope . | WT distance (nm) . | TtnΔA164–167 distance (nm) . | Difference (nm) . | P value . | Significance . |
|---|---|---|---|---|---|
| M8–M10 | 41 ± 5 | 43 ± 6 | 2 | 0.5223 | ns |
| A168–170 α | 87 ± 6 | 70 ± 11 | 17 | 0.0473 | * |
| A168–170 β | 125 ± 6 | - | - | - | |
| cMyBP-C 1 | 165 ± 8 | 126 ± 13 | 39 | 0.0052 | ** |
| A77–78 | 443 ± 21 | 407 ± 21 | 37 | 0.0032 | ** |
| cMyBP-C 9 | 509 ± 11 | 463 ± 14 | 46 | 0.0057 | ** |
| Ti102 | 776 ± 33 | 736 ± 27 | 40 | 0.0097 | ** |
For each antibody, the measured distance from the center of the sarcomere (middle of M-band) to the epitope is listed for WT and TtnΔA164–167 (±SD). The calculated difference between the WT and TtnΔA164–167 distance is listed for each epitope, with statistical significance determined by a nested t test. The list is in order from closest to the M-line to farthest from the M-line. For titin epitopes in the distal part of the A-band (A77–78 and Ti102/MIR), we have only included data in the sarcomere length range of 1,700–2,300 nm. For titin epitopes more proximal to the M-band (A168–170 and M8–M10) and MyBP-C, data are from sarcomeres ranging in length from ∼2,000 to 2,600 nm. See Fig. S6 for epitope distance–sarcomere length relationships. ns, p ≥ 0.05; * p ≤ 0.05; ** p ≤0.01.
Titin’s P-zone domains A168–170 lie immediately adjacent to the deleted domains A164–167 (Fig. 7 A), and immunolabeling with an antibody against these domains in WT mice yields two stripes on either side of the M-band when visualized by EM (Fig. 7 C, left). We interpret these two stripes to correspond to titin’s two conformations in this region, titin α and titin β, as described by Tamborrini et al. (2023). In our experiments, the titin α A168–170 epitope measured an average of 87 nm from the sarcomere center in WT mice, while the titin β epitope measured 125 nm from the center (a separation of 38 nm). In TtnΔA164–167 mice, however, only one stripe was labeled by the A168–170 antibody, at a mean distance of 70 nm from the center (Fig. 7 C [right] and Table 1). This is an average shift toward the M-band of 17 nm from the WT titin α location and 55 nm from the WT titin β location (Fig. 7 C and Table 1).
We next probed titin’s location in the C-zone with an antibody against domains A77–78 (C-zone super-repeat 4) (Fig. 7 A). In WT LV, this antibody label was measured to localize an average of 443 nm from the center of the sarcomere, while in TtnΔA164–167 LV, it localized an average of 407 nm from the center. The location of titin domains A77–78 is therefore shifted 37 nm toward the M-band in TtnΔA164–167 mice (Fig. 7 D and Table 1).
We lastly probed the location of the edge of titin’s A-band with the Ti102 and MIR antibodies (Fig. 7 A). The Ti102 antibody binds to domains I111 and I112, and the MIR antibody binds to domains I109–I111 in the I/A junction, near the edge of the thick filament (Jin, 1995; Skeie et al., 1997). Since their epitopes overlap, both antibodies were used in experiments. In WT LV sarcomeres, the average epitope distance from the center of the sarcomere was 776 nm. In TtnΔA164–167 sarcomeres, this distance was 736 nm (Fig. 7 E and Table 1), a shift of 40 nm toward the center of the sarcomere. Together, the titin epitope measurements show that titin’s C terminus is incorporated normally, that its α and β conformations are disrupted, and that epitopes distal to the A164–167 deletion are shifted uniformly by ∼40 nm in TtnΔA164–167 mice (Fig. 7 E and Table 1).
Thick filament length
Since titin is considered a thick filament template, we next examined whether the thick filament itself was altered. We measured A-band length in the immunoelectron micrographs from which titin epitopes were measured above (see Materials and methods for shrinkage correction details). The average thick filament length in WT samples was 1,531 nm, while in TtnΔA164–167 samples, it was 1,428 nm (Fig. 8 A). Per half-sarcomere, these values are 765 nm (WT) and 714 nm (TtnΔA164–167), close to the titin A-band segment length of 776 and 735 nm, respectively, as indicated by the Ti102 and MIR antibodies.
At the top, in panel A, two grayscale electron microscopy images show the physical muscle fibers; the W T image displays a regular, repeating pattern of dark and light bands, while the Ttn Delta A164-167 image shows a similar but slightly more compressed striated pattern. Below these, two corresponding line graphs plot the Gray Value on the vertical axis (ranging from 0 to 150 for W T and 0 to 200 for the mutant) against Distance in nanometers on the horizontal axis (ranging from 0 to 2,000 with increments of 1000). Each graph features Z peaks representing Z-discs, with a red double-headed arrow spanning the A-band region between two vertical dashed lines. On the far right, a bar graph titled Cardiac A-band summarizes the data. The vertical axis represents Length in nanometers, ranging from 0 to 2,000 with increments of 1000, while the horizontal axis identifies the W T (gray bar) and Ttn Delta A164-167 (blue bar) groups. Numerous individual data points, represented as small open circles, are clustered around the top of each bar at approximately the 1,500-nanometer mark. A horizontal bracket connects the two bars with the value 0.0585 written above it, indicating the statistical p-value of the comparison. Panel B displays a detailed structural analysis of muscle sarcomeres, comparing a wild-type (W T) sample to a mutant (Ttn Delta A164-167) sample. At the top of each panel, grayscale electron microscopy images show the physical striations of the muscle fibers, where darker regions correspond to higher protein density. Below these images, two line graphs represent the density profiles. The vertical axis in both graphs measures the Gray Value, ranging from 50 to 200 with increments of 50, while the horizontal axis measures Distance in nanometers, ranging from 0 to 2,500 with increments of 500 (indicated by major ticks). Each graph features distinct peaks labeled Z at the outer edges, representing the Z-discs. In the center of the graphs, specifically between 1,200 and 1,800 nanometers, there are nine small, distinct peaks marked by red downward-pointing arrows and numbered 1 and 9 at the boundaries. These peaks represent specific periodic structures within the A-band, likely C-zone stripes. In the WT profile, these peaks appear well-defined and spread over a wider distance compared to the mutant Ttn Delta A164-167 profile, where the entire sarcomere pattern appears slightly shifted and compressed toward the left. Panels C and D provide a quantitative analysis of the C-zone and specific Myosin Binding Protein-C (MyB P-C) stripes within the cardiac sarcomere, comparing wild-type (W T) and mutant (Ttn Delta A164-167) samples. Graph C contains a bar graph titled C-zone length, where the vertical axis represents Length in nanometers (ranging from 0 to 400 with increments of 100), and the horizontal axis categorizes the W T (gray bar) and Ttn Delta A164-167 (blue bar) groups. Individual data points are shown as small open circles, with both bars reaching a height of approximately 320 nanometers; a bracket labeled ns (non-significant) indicates no statistical difference in total length between the two genotypes. Graph D, titled Cardiac My B P-C, features a histogram and density plot where the vertical axis represents Count (ranging from 0 to 40 with increments of 10) and the horizontal axis represents Distance to middle of M-band in nanometers (ranging from 0 to 600 with increments of 200, with minor ticks every 20 nanometers). The plot reveals a spatial shift in protein distribution: W T stripe 1 (gray) is centered at 166 nanometers, while the mutant stripe 1 (blue) is shifted left to 126 nanometers, and W T stripe 9 (gray) is centered at 509 nanometers, while the mutant stripe 9 (blue) is shifted left to 463 nanometers.
Measuring thick filament length and mapping cMyBP-C. (A) Representative electron micrographs of WT (left) and TtnΔA164–167 (right) sarcomeres, with plot profiles below in which the length of the A-band was measured as indicated by the red arrows (example sarcomeres labeled with M8M10 antibody) and Z-disks are marked. Measured A-band length is plotted to the right. Data were compiled from n = 3–4 mice/genotype, with 136–213 sarcomeres measured. Statistical significance was determined by a nested t test (nested by mouse). (B) Representative electron micrographs of WT (left) and TtnΔA164–167 (right) sarcomeres labeled with antibody against cMyBP-C with plot profile below. Stripes 1–9 on the right half of the sarcomere are labeled by red arrows, with stripe 1 and stripe 9 numbered, and Z-disks are marked. (C) C-zone length (distance from M-band for MyBP-C stripe 9 minus distance from M-band for MyBP-C stripe 1). (D) Frequency distribution of distance measurements for stripe 1 from the center of the M-band and stripe 9 from the center of the M-band. Stripe 1 is represented by the lighter blue and gray bars (left side of the plot), and stripe 9 is represented by the darker blue and gray bars (right side of the plot). The average distance for each stripe for each genotype is labeled on the plot. For panels C and D, N = 2 mice/genotype, with 51–60 sarcomeres measured. Statistical significance for C and D was determined by a nested t test (nested by mouse). The average distance, standard deviation, difference between genotypes, and statistical significance are detailed in Table 1.
At the top, in panel A, two grayscale electron microscopy images show the physical muscle fibers; the W T image displays a regular, repeating pattern of dark and light bands, while the Ttn Delta A164-167 image shows a similar but slightly more compressed striated pattern. Below these, two corresponding line graphs plot the Gray Value on the vertical axis (ranging from 0 to 150 for W T and 0 to 200 for the mutant) against Distance in nanometers on the horizontal axis (ranging from 0 to 2,000 with increments of 1000). Each graph features Z peaks representing Z-discs, with a red double-headed arrow spanning the A-band region between two vertical dashed lines. On the far right, a bar graph titled Cardiac A-band summarizes the data. The vertical axis represents Length in nanometers, ranging from 0 to 2,000 with increments of 1000, while the horizontal axis identifies the W T (gray bar) and Ttn Delta A164-167 (blue bar) groups. Numerous individual data points, represented as small open circles, are clustered around the top of each bar at approximately the 1,500-nanometer mark. A horizontal bracket connects the two bars with the value 0.0585 written above it, indicating the statistical p-value of the comparison. Panel B displays a detailed structural analysis of muscle sarcomeres, comparing a wild-type (W T) sample to a mutant (Ttn Delta A164-167) sample. At the top of each panel, grayscale electron microscopy images show the physical striations of the muscle fibers, where darker regions correspond to higher protein density. Below these images, two line graphs represent the density profiles. The vertical axis in both graphs measures the Gray Value, ranging from 50 to 200 with increments of 50, while the horizontal axis measures Distance in nanometers, ranging from 0 to 2,500 with increments of 500 (indicated by major ticks). Each graph features distinct peaks labeled Z at the outer edges, representing the Z-discs. In the center of the graphs, specifically between 1,200 and 1,800 nanometers, there are nine small, distinct peaks marked by red downward-pointing arrows and numbered 1 and 9 at the boundaries. These peaks represent specific periodic structures within the A-band, likely C-zone stripes. In the WT profile, these peaks appear well-defined and spread over a wider distance compared to the mutant Ttn Delta A164-167 profile, where the entire sarcomere pattern appears slightly shifted and compressed toward the left. Panels C and D provide a quantitative analysis of the C-zone and specific Myosin Binding Protein-C (MyB P-C) stripes within the cardiac sarcomere, comparing wild-type (W T) and mutant (Ttn Delta A164-167) samples. Graph C contains a bar graph titled C-zone length, where the vertical axis represents Length in nanometers (ranging from 0 to 400 with increments of 100), and the horizontal axis categorizes the W T (gray bar) and Ttn Delta A164-167 (blue bar) groups. Individual data points are shown as small open circles, with both bars reaching a height of approximately 320 nanometers; a bracket labeled ns (non-significant) indicates no statistical difference in total length between the two genotypes. Graph D, titled Cardiac My B P-C, features a histogram and density plot where the vertical axis represents Count (ranging from 0 to 40 with increments of 10) and the horizontal axis represents Distance to middle of M-band in nanometers (ranging from 0 to 600 with increments of 200, with minor ticks every 20 nanometers). The plot reveals a spatial shift in protein distribution: W T stripe 1 (gray) is centered at 166 nanometers, while the mutant stripe 1 (blue) is shifted left to 126 nanometers, and W T stripe 9 (gray) is centered at 509 nanometers, while the mutant stripe 9 (blue) is shifted left to 463 nanometers.
Measuring thick filament length and mapping cMyBP-C. (A) Representative electron micrographs of WT (left) and TtnΔA164–167 (right) sarcomeres, with plot profiles below in which the length of the A-band was measured as indicated by the red arrows (example sarcomeres labeled with M8M10 antibody) and Z-disks are marked. Measured A-band length is plotted to the right. Data were compiled from n = 3–4 mice/genotype, with 136–213 sarcomeres measured. Statistical significance was determined by a nested t test (nested by mouse). (B) Representative electron micrographs of WT (left) and TtnΔA164–167 (right) sarcomeres labeled with antibody against cMyBP-C with plot profile below. Stripes 1–9 on the right half of the sarcomere are labeled by red arrows, with stripe 1 and stripe 9 numbered, and Z-disks are marked. (C) C-zone length (distance from M-band for MyBP-C stripe 9 minus distance from M-band for MyBP-C stripe 1). (D) Frequency distribution of distance measurements for stripe 1 from the center of the M-band and stripe 9 from the center of the M-band. Stripe 1 is represented by the lighter blue and gray bars (left side of the plot), and stripe 9 is represented by the darker blue and gray bars (right side of the plot). The average distance for each stripe for each genotype is labeled on the plot. For panels C and D, N = 2 mice/genotype, with 51–60 sarcomeres measured. Statistical significance for C and D was determined by a nested t test (nested by mouse). The average distance, standard deviation, difference between genotypes, and statistical significance are detailed in Table 1.
MyBP-C location
Lastly, we examined the location of a prominent thick filament accessory protein, cMyBP-C, using an antibody against domains C5–C7 (Luther et al., 2008), visualized by EM (Fig. 8 B). There are nine cMyBP-C stripes per half A-band, spaced 43 nm apart (in correlation with the length of a myosin helical repeat and a titin C-zone super-repeat), aligning with titin C-zone super-repeats 2 through 11 (Tonino et al., 2019; Bennett et al., 2020; Dutta et al., 2023; Tamborrini et al., 2023). Our findings indicate that the width of the C-zone (distance from stripe 1 to stripe 9) does not differ between WT and TtnΔA164–167 mice (Fig. 8 C). Although the spacing of the cMyBP-C stripes is normal, their location within the thick filament differs from WT in TtnΔA164–167 mice. While stripe 1 localized to 165 nm from the center of the sarcomere in WT mice, it localized to 126 nm in TtnΔA164–167 mice, a difference of 39 nm (Fig. 8 D and Table 1). Stripe 9 measured 509 nm from the center of the sarcomere in WT mice but was shifted toward the M-band by 46 nm in TtnΔA164–167 mice to an average of 463 nm from the center (Fig. 8 D and Table 1). These shifts are similar to the titin epitope shifts found in the C-zone and at the edge of the A-band (around 40 nm) and are consistent across a range of sarcomere lengths (Fig. S6). All epitope measurements are summarized in Table 1, and all epitope distance–sarcomere length relationships are plotted in (Fig. S6).
Graph A (I E M Correction Factor (My B P C)): The vertical axis represents the Correction Factor (unitless), ranging from 1.00 to 1.15 with increments of 0.05, while the horizontal axis represents Sarcomere Length in micrometers, ranging from 1800 to 2600 with increments of 200. A linear regression line follows the equation y equals minus 0.0001299x plus 1.457 across the black data points. Graph B (M8-M10 versus S L): The vertical axis shows the Distance from M-line in nanometers, ranging from 0 to 80 with increments of 20, and the horizontal axis shows Sarcomere Length in nanometers, ranging from 1800 to 2800 with increments of 200. W T (gray circles) and Ttn Delta A164-167 (blue circles) data points cluster horizontally around 40 nanometers. Graph C (A168-170 versus S L): The vertical axis measures Distance from M-line in nanometers, ranging from 0 to 200 with increments of 50, while the horizontal axis measures Sarcomere Length in nanometers, ranging from 1800 to 2800 with increments of 200. Three distinct populations are visible: W T alpha (top gray) at approximately 120 nanometers, W T beta (middle gray) at approximately 80 nanometers, and Ttn Delta A164-167 (blue) at approximately 70 nanometers. Graph D (Ti102/M I R versus S L): The vertical axis represents Distance from M-line in nanometers, ranging from 400 to 1200 with increments of 200, and the horizontal axis represents Sarcomere Length in nanometers, ranging from 1500 to 2500 with increments of 500. Both W T (gray) and Ttn Delta A164-167 (blue) show a positive linear slope, with vertical dashed lines marking a specific range between 1700 and 2300 nanometers. Graph E (A77-78 versus S L): The vertical axis measures the Distance from M-line in nanometers, ranging from 300 to 600 with increments of 100, while the horizontal axis represents Sarcomere Length in nanometers, ranging from 1500 to 3000 with increments of 500. Vertical dotted lines at approximately 1700 and 2300 nanometers highlight a specific analysis range where W T data (gray) appears slightly higher than the mutant data (blue). Graph F (cMyB P C stripe 1 versus S L): The vertical axis represents Distance from M-line in nanometers, ranging from 100 to 200 with increments of 20, and the horizontal axis represents Sarcomere length in nanometers, ranging from 1800 to 2800 with increments of 200. The W T data points (gray) show a distribution centered around 165 nanometers, which is significantly higher than the mutant distribution (blue) centered near 125 nanometers. Graph G (cMy B P C stripe 9 versus S L): The vertical axis measures Distance from M-line in nanometers, ranging from 400 to 600 with increments of 50, while the horizontal axis represents Sarcomere length in nanometers, ranging from 1800 to 2800 with increments of 200. Consistent with panel F, the W T data (gray) sit at a higher position (approximately 510) compared to the mutant data (blue), which clusters around 465 nanometers. All values are approximate.
Shrinkage correction and epitope distance vs. sarcomere length relationship. (A) Correction factor calculated for each image stained with cMyBP-C antibody is plotted against the average sarcomere length of the sarcomeres in that image to generate a standard curve whose equation can be used to calculate the correction factor for an image not stained with cMyBP-C antibody based on the average length of the sarcomeres in that image. (B–G). Epitope distance from M-band vs. sarcomere length for: B. M8–M10, C. A168–170, D. A77–78, E. Ti102/MIR, F. cMyBP-C stripe 1, and G. cMyBP-C stripe 9. Data in manuscript are restricted to SL = 1,700–2,300 nm (indicated by dotted vertical lines) for A77–78 and Ti102/MIR.
Graph A (I E M Correction Factor (My B P C)): The vertical axis represents the Correction Factor (unitless), ranging from 1.00 to 1.15 with increments of 0.05, while the horizontal axis represents Sarcomere Length in micrometers, ranging from 1800 to 2600 with increments of 200. A linear regression line follows the equation y equals minus 0.0001299x plus 1.457 across the black data points. Graph B (M8-M10 versus S L): The vertical axis shows the Distance from M-line in nanometers, ranging from 0 to 80 with increments of 20, and the horizontal axis shows Sarcomere Length in nanometers, ranging from 1800 to 2800 with increments of 200. W T (gray circles) and Ttn Delta A164-167 (blue circles) data points cluster horizontally around 40 nanometers. Graph C (A168-170 versus S L): The vertical axis measures Distance from M-line in nanometers, ranging from 0 to 200 with increments of 50, while the horizontal axis measures Sarcomere Length in nanometers, ranging from 1800 to 2800 with increments of 200. Three distinct populations are visible: W T alpha (top gray) at approximately 120 nanometers, W T beta (middle gray) at approximately 80 nanometers, and Ttn Delta A164-167 (blue) at approximately 70 nanometers. Graph D (Ti102/M I R versus S L): The vertical axis represents Distance from M-line in nanometers, ranging from 400 to 1200 with increments of 200, and the horizontal axis represents Sarcomere Length in nanometers, ranging from 1500 to 2500 with increments of 500. Both W T (gray) and Ttn Delta A164-167 (blue) show a positive linear slope, with vertical dashed lines marking a specific range between 1700 and 2300 nanometers. Graph E (A77-78 versus S L): The vertical axis measures the Distance from M-line in nanometers, ranging from 300 to 600 with increments of 100, while the horizontal axis represents Sarcomere Length in nanometers, ranging from 1500 to 3000 with increments of 500. Vertical dotted lines at approximately 1700 and 2300 nanometers highlight a specific analysis range where W T data (gray) appears slightly higher than the mutant data (blue). Graph F (cMyB P C stripe 1 versus S L): The vertical axis represents Distance from M-line in nanometers, ranging from 100 to 200 with increments of 20, and the horizontal axis represents Sarcomere length in nanometers, ranging from 1800 to 2800 with increments of 200. The W T data points (gray) show a distribution centered around 165 nanometers, which is significantly higher than the mutant distribution (blue) centered near 125 nanometers. Graph G (cMy B P C stripe 9 versus S L): The vertical axis measures Distance from M-line in nanometers, ranging from 400 to 600 with increments of 50, while the horizontal axis represents Sarcomere length in nanometers, ranging from 1800 to 2800 with increments of 200. Consistent with panel F, the W T data (gray) sit at a higher position (approximately 510) compared to the mutant data (blue), which clusters around 465 nanometers. All values are approximate.
Shrinkage correction and epitope distance vs. sarcomere length relationship. (A) Correction factor calculated for each image stained with cMyBP-C antibody is plotted against the average sarcomere length of the sarcomeres in that image to generate a standard curve whose equation can be used to calculate the correction factor for an image not stained with cMyBP-C antibody based on the average length of the sarcomeres in that image. (B–G). Epitope distance from M-band vs. sarcomere length for: B. M8–M10, C. A168–170, D. A77–78, E. Ti102/MIR, F. cMyBP-C stripe 1, and G. cMyBP-C stripe 9. Data in manuscript are restricted to SL = 1,700–2,300 nm (indicated by dotted vertical lines) for A77–78 and Ti102/MIR.
Discussion
Various regions of titin have been systematically studied using deletion mouse models (Chung et al., 2013; Buck et al., 2014; Granzier et al., 2009; Granzier et al., 2014; Brynnel et al., 2018; van der Pijl et al., 2020; Radke et al., 2007; Lee et al., 2010; Tonino et al., 2017; Tonino et al., 2019; Gotthardt et al., 2003; Biquand et al., 2021), but the P-zone (domains A164–170) has not received much attention yet. The A164–167 segment’s unique domain sequence (Ig-Ig-FnIII-FnIII) and conservation across vertebrate titins and invertebrate twitchins (Obermann et al., 1996; Labeit et al., 1992) suggest that it is a necessary element of the titin molecule. In the sarcomere, titin incorporates into the thick filament and is thought to serve as a molecular template for thick filament assembly (Dutta et al., 2023; Tonino et al., 2017; Bennett et al., 2020; Fleming et al., 2023; Bennett and Gautel, 1996) and support regulation of thick filament activation (Park-Holohan et al., 2021) (reviewed in Granzier and Labeit [2025] and Brunello and Fusi [2024]). A high-resolution structure of the relaxed cardiac thick filament C-zone was recently published, which revealed that titin maintains precise structural patterns (e.g., kinks at each Ig-like domain in the C-zone that facilitate contacts between titin dimers and between titin and myosin) throughout the filament that likely contribute to its templating and regulatory functions (Dutta et al., 2023; Tamborrini et al., 2023). At the C-zone-to-P-zone transition, titin adopts two conformations: the α conformation, in which titin runs linearly through the P-zone and into the M-band, with domains A164–A167 positioned alongside myosin crowns P3 and P2; and the β conformation, in which a loop comprising domains A158–A167 wraps around the neck of myosins in crown A2 (Tamborrini et al., 2023). Following the loop, domains A168 through M1 are arranged linearly alongside myosin crown A1. Each thick filament contains three pairs of titin molecules, and within each pair, one molecule is thought to adopt the α conformation, while the other adopts the β conformation. Therefore, while six titin molecules run through the C-zone of the sarcomere, only three titin molecules might extend into the M-band.
The four titin P-zone domains (A164–A167) missing in the TtnΔA164–167 mouse correspond to ∼16 nm of titin’s length. Thus, TtnΔA164–167 titin is ∼16 nm shorter than WT titin, and we expected that IEM studies would reveal titin epitope shifts of that magnitude. We first probed the location of titin’s C-terminal end using the M8-M10 antibody and found that it is normally incorporated in the TtnΔA164–167 sarcomere. The location of the remaining P-zone domains, A168–170, was studied with an antibody against this three-domain segment. In WT mice, two epitopes were detected, ∼40 nm apart (87 and 125 nm from the center of the sarcomere). This is the first antibody-based evidence of two titin conformations in the P-zone, and we interpret these two epitopes to correspond to the A168–170 location in titin α (87-nm stripe) and titin β (125-nm stripe), in agreement with the layout of titin established by Tamborrini et al. (2023). In TtnΔA164–167 LV, only one stripe was labeled by the A168–170 antibody, which was closer to the M-band than the WT α titin epitope by ∼17 nm (70 nm from the sarcomere center). The presence of only one epitope suggests that all titin molecules adopt the same conformation in the TtnΔA164–167 sarcomere, and, thus, that domains A164–167 are necessary for the β loop to form. In WT titin α, where titin domains are linearly arranged, the measured distance from M8–M10 to A168–170 is ∼43 nm. In TtnΔA164–167 titin, the measured distance from M8-M10 to A168–170 is ∼30 nm. This M-ward shift of the A168–170 epitope was unexpected considering the M8–M10 epitope was positioned normally. This shift could be accounted for by rearrangements of titin’s M-band M-is, particularly the large and flexible M-is2 segment (which lies between the M8–M10 and A168–170 epitopes) (Lange et al., 2002; Bang et al., 2001), in response to the misalignment caused by the deletion.
Titin’s C-zone was studied using the A77–78 antibody and the I/A junction studied using the Ti102 and MIR antibodies. Both the C-zone and I/A junction epitopes were located ∼40 nm closer to the M-band in TtnΔA164–167 sarcomeres. In WT mice, the Ti102/MIR epitope localizes at the edge of the thick filament and the distance across the M-band to the corresponding epitope represents thick filament length. In the case of the TtnΔA164–167 model, it seemed plausible that the thick filament remained the same length despite that titin’s A-band segment had shifted, or that the thick filament shortened such that the Ti102/MIR epitope remained at the edge. We tested this by measuring the thick filament length in electron micrographs and found slightly shorter thick filaments in TtnΔA164–167 sarcomeres, by ∼50 nm per half-thick filament, which is in relatively good agreement with the Ti102/MIR epitope shift. Thus, in the TtnΔA164–167 mouse, titin’s distal A-band epitopes localize closer to the M-band by ∼40 nm and the thick filament shortened accordingly.
We also measured the location of cMyBP-C stripes by IEM and found that in TtnΔA164–167 sarcomeres, the C-zone, with edges demarcated by cMyBP-C stripes 1 and 9, had shifted toward the M-band by ∼43 nm. Interestingly, the location of cMyBP-C stripe 1 in TtnΔA164–167 sarcomeres occupied the location of the titin β A168–170 epitope in WT sarcomeres, and the TtnΔA164–167 C-zone shift corresponds closely to the length of a C-zone super-repeat and a myosin helical repeat (3 crowns, 43 nm). This shift matches closely with the ∼40-nm shifts in titin A77–78 and Ti102/MIR epitope and suggests that the TtnΔA164–167 thick filament components in the C-zone and beyond rearranged such that they remained in register with each other, as opposed to titin shifting independently of the other thick filament components as initially hypothesized. This leads us to propose a structural model of the thick filament in TtnΔA164–167 mice in which the 3 myosin crowns in the P-zone are missing (crowns P1, P2, and P3), which would shorten the half-thick filament by 43 nm, thereby placing the first C-zone myosin crowns (crowns A1, A2, and A3) in the location normally occupied by the P-zone crowns (Fig. 9). Knowing titin’s role as a thick filament template, it seems likely that missing domains in the P-zone impair the ability of the myosin molecules in that region to assemble, resulting in the crown-bearing region of the thick filament starting with the C-zone crowns instead.
Panel A shows the standard longitudinal arrangement of sarcomere proteins starting from the M-band (pink) and moving through the P-zone (green), C-zone (light blue), and D-zone (tan) toward the I/A junction (purple). The protein layers are labeled from top to bottom as My B P-C, Myosin, Titin beta, and Titin alpha. In the C-zone, the diagram displays eleven distinct segments labeled C-zone 11 through C-zone 6. A key feature identified in the Titin beta strand within the C-zone 11 region is a beta loop, which is indicated by a black vertical arrow. The Titin alpha and beta strands consist of alternating white and purple oval subunits, which align precisely with the myosin heads and My B P-C structures. Panel B illustrates the structural alterations caused by the Titin Delta A164-167 mutation. While the overall zones (M-band, P-zone, C-zone, D-zone) remain, the Titin strands show a physical deformity labeled as a kink located in the C-zone 11 segment. This kink replaces the smooth loop structure seen in the wild-type and appears as a sharp upward and downward displacement of the Titin strands. Due to the deletion of the four specific exons, the segments of the C-zone are shifted toward the M-band. This shift is highlighted by dashed blue lines connecting the wild-type segments to the mutant segments, showing that the mutant C-zone 5 is now pulled into the visible frame where C-zone 6 was previously located. Additionally, the P-zone width (indicated by a green double-headed arrow) is significantly shorter in the mutant compared to the wild-type.
Proposed model of the WT (A) and TtnΔA164–167 (B) thick filament. (A and B) The thick filament components (titin, myosin, and cMyBP-C) are shown vertically stacked for clarity (labels to the right). The myosin molecules in the P-zone (P1, P2, P3) are orange, and the myosin molecules in the C-zone are peach. Ig domains of titin and cMyBP-C are magenta, FnIII domains are white, and titin’s kinase domain is indigo. The deletion of titin domains A164–167 shifts titin’s P-zone toward the M-band and results in a kinked titin conformation in titin’s C-zone 11-domain super-repeats. All other titin C-zone repeats moved 43 nm closer toward the M-band and are correctly phased with myosin and cMyBP-C. The shift in location from WT to TtnΔA164–167 is marked by dotted lines corresponding to the color of the zone.
Panel A shows the standard longitudinal arrangement of sarcomere proteins starting from the M-band (pink) and moving through the P-zone (green), C-zone (light blue), and D-zone (tan) toward the I/A junction (purple). The protein layers are labeled from top to bottom as My B P-C, Myosin, Titin beta, and Titin alpha. In the C-zone, the diagram displays eleven distinct segments labeled C-zone 11 through C-zone 6. A key feature identified in the Titin beta strand within the C-zone 11 region is a beta loop, which is indicated by a black vertical arrow. The Titin alpha and beta strands consist of alternating white and purple oval subunits, which align precisely with the myosin heads and My B P-C structures. Panel B illustrates the structural alterations caused by the Titin Delta A164-167 mutation. While the overall zones (M-band, P-zone, C-zone, D-zone) remain, the Titin strands show a physical deformity labeled as a kink located in the C-zone 11 segment. This kink replaces the smooth loop structure seen in the wild-type and appears as a sharp upward and downward displacement of the Titin strands. Due to the deletion of the four specific exons, the segments of the C-zone are shifted toward the M-band. This shift is highlighted by dashed blue lines connecting the wild-type segments to the mutant segments, showing that the mutant C-zone 5 is now pulled into the visible frame where C-zone 6 was previously located. Additionally, the P-zone width (indicated by a green double-headed arrow) is significantly shorter in the mutant compared to the wild-type.
Proposed model of the WT (A) and TtnΔA164–167 (B) thick filament. (A and B) The thick filament components (titin, myosin, and cMyBP-C) are shown vertically stacked for clarity (labels to the right). The myosin molecules in the P-zone (P1, P2, P3) are orange, and the myosin molecules in the C-zone are peach. Ig domains of titin and cMyBP-C are magenta, FnIII domains are white, and titin’s kinase domain is indigo. The deletion of titin domains A164–167 shifts titin’s P-zone toward the M-band and results in a kinked titin conformation in titin’s C-zone 11-domain super-repeats. All other titin C-zone repeats moved 43 nm closer toward the M-band and are correctly phased with myosin and cMyBP-C. The shift in location from WT to TtnΔA164–167 is marked by dotted lines corresponding to the color of the zone.
The reduction in thick filament length observed in TtnΔA164–167 mice is predicted to influence both active and passive stress generation. Loss of a single myosin helical repeat (three crowns, nine myosin molecules) represents ∼6% of the 147 myosin molecules comprising a half-thick filament (Craig and Offer, 1976a), suggesting an expected ∼6% decrease in maximal active stress generated by TtnΔA164–167 sarcomeres. However, no reduction was detected in skinned cardiac myocytes or skeletal muscle fibers (Fig. 3 E and Fig. 4 F). This absence of a measurable effect may reflect the inherent variability of maximal active stress measurements, stemming from factors such as variation in sarcomere length during contraction and uncertainty in fiber CSA, which could obscure a change of this magnitude. Alternatively, this could reflect inherently different regulation and/or activation of the TtnΔA164–167 thick filament in compensation for the shortened length (discussed further below).
At the intact muscle level, EDL muscles from TtnΔA164–167 mice showed a ∼30% reduction in maximal active stress (Fig. 5 A), far greater than the ∼6% expected from thick filament shortening. The underlying cause of this disproportionate decrease remains unknown. Note that the ∼30% reduction in CSA of the skinned IIB fibers used for mechanical experiments was consistent in magnitude with the ∼30% decrease in absolute whole-muscle force generation, in line with the possibility of the muscle having less myofibrillar force-generating area. Fiber-type switching toward slower IIA/IIX fibers likely also contributes to the reduction in whole EDL force generation, which would not have been detected in skinned fiber mechanics, which focused solely on IIB fibers. Intact soleus contractile function was also examined and showed a minimal decrease in force generation at high stimulation frequencies, along with a significant upregulation of type I fibers (and concomitant decrease in the content of type IIA and IIX fibers) (Fig. S4). We hypothesize that the differential impact of the titin A164–167 deletion on EDL vs. soleus muscles may stem from the inherent difference in thick filament activation and regulation in fast- vs. slow-twitch muscles that may allow the soleus muscle to better compensate for structural changes than the EDL (Gong et al., 2022). Furthermore, if increased energetic demands due to compensatory mechanisms are a driver of the phenotype, it is possible that the increased mitochondrial content of type I fibers (Leary et al., 2003) allows them to perform better than type II fibers in TtnΔA164–167 muscles.
At the whole heart level, echocardiography analysis revealed no difference in systolic performance between genotypes (Fig. 6 A), implying that the heart may compensate for the expected 6% loss in force due to thick filament shortening. As mentioned above, one possible mechanism for this could be differences in the regulatory state of the myosin heads, which titin is known to influence (Park-Holohan et al., 2021; Squarci et al., 2023). Myosin heads can be positioned in an “ON” (available to form cross-bridges) or “OFF” (folded against the thick filament backbone in the interacting head motif and acting as a reserve) state (Ma et al., 2023; Grinzato et al., 2023; Mann et al., 2020). Perturbations to the regulatory state of the thick filament (e.g., myosin mutations that cause hypercontractility) can trigger compensatory responses, such as cardiac remodeling, as seen in the present study (reviewed in Spudich [2019]). In the case of the TtnΔA164–167 mouse model, we observed organ-level morphological remodeling. Echocardiography revealed LV enlargement, and cardiac chamber weights were significantly increased. The structural changes caused by deletion of domains A164–167 might result in an increase in the ON state of the thick filament, preserving contractile function in the short term. This increased demand likely underlies the enlarged heart observed in the TtnΔA164–167 mouse model. Additionally, greater myosin activity elevates mitochondrial ATP demand, potentially driving mitochondrial remodeling (reviewed in Botella et al. (2023), Lazaropoulos and Elrod [2022], and Abel and Doenst [2011]). Consistent with this, RNA-seq analysis of the TtnΔA164–167 LV showed enrichment for GO terms associated with mitochondrial components, fatty acid metabolism, glycogen metabolism, and glycolysis. Metabolic pathway shifts from oxidative to glycolytic metabolism have been documented in DCM and HCM, as well as changes to ERK/MAPK signaling, which were also detected at the transcriptional level (Muchir et al., 2010; Dávila-Román et al., 2002; Gallo et al., 2019; Schafer et al., 2017; Lumish et al., 2024). Fibrotic remodeling, another common feature of pathological adaptation, is also suggested by enrichment of the collagen-containing extracellular matrix GO term, although this was not detected by cardiac histology at the 3-mo age point.
We also examined the passive stress-generating properties of both the EDL and the heart muscle in response to the deletion of domains A164–167 and the resulting shorter thick filaments. In sarcomeres with shortened thick filaments, titin’s extensible I-band segment is longer at any given sarcomere length, and passive stress is therefore expected to be elevated in TtnΔA164–167 mice. WLC modeling, which incorporates both the shorter thick filament and I-band splicing effects, predicted a large, combined increase in EDL passive stress, ∼100% at a sarcomere length of 3.0 μm (Fig. S5 A). Single-fiber measurements confirmed significant elevations in passive stress but to a lesser extent than predicted (∼30% increase at SL 3.0 μm). This smaller-than-expected increase may reflect deviations from WLC model assumptions, particularly the absence of Ig domain unfolding. Notably, unfolding of a single Ig domain increases its contour length by ∼25 nm (Watanabe et al., 2002a), which could substantially offset the effect of shortening of the thick filament.
In the LV tissue, titin splicing analysis revealed no differences between genotypes, indicating that any change in passive stress arises solely from increased strain on titin’s I-band due to shorter thick filaments. The WLC model predicted increased titin-based passive stress in TtnΔA164–167 cardiac sarcomeres, ∼50% higher than WT in the 2.2–2.3 µm sarcomere length range (the upper physiological limit; Fig. S5 B). However, skinned myocyte measurements showed only small increases in passive stress, significant only when comparing fitted sarcomere length–stress curves between genotypes (Fig. 4, A–D). The smaller-than-predicted effect may reflect Ig domain unfolding in the proximal or distal tandem Ig segments (Minajeva et al., 2001) or variability inherent to skinned myocyte measurements, as discussed above. Furthermore, posttranslational modifications play a significant role in modulating titin stiffness and are frequently imbalanced during cardiac disease states (reviewed in Hidalgo and Granzier (2013) and Loescher et al. (2022)), which adds another layer of complexity that is not accounted for in the WLC model. At the organ level, echocardiography revealed mild diastolic filling impairment, evidenced by a shorter mitral valve deceleration time and increased atrial weight (Fig. 6). We probed the TtnΔA164–167 hearts for fibrosis as a possible explanation for the organ-level diastolic impairments (Conrad et al., 1995) but found no overt fibrosis at 3 mo of age. While diastolic dysfunction can have multiple causes including fibrosis, increased titin-based passive stiffness is a major contributor (Granzier and Irving, 1995; Chung and Granzier, 2011; Lin et al., 2022; Makarenko et al., 2004), and our findings overall are consistent with elevated titin-based passive stress in the TtnΔA164–167 model. Further research probing titin posttranslational modifications will be required to fully understand the mechanism of the mild diastolic filling changes.
Future work aims to better understand the mechanism of both cardiac and skeletal functional changes, with a particular emphasis on understanding how the phenotype of this mouse model may evolve with age. In cardiac muscle, our findings are consistent with the notion that the TtnΔA164–167 heart is undergoing active remodeling in response to increased energetic demands imposed by thick filament structural perturbations. We hypothesize that at 3 mo of age, the heart is in a state of compensation, where contractility is rescued by overactivation of the thick filament. As is the case in many cardiomyopathies, we hypothesize that the compensated state will eventually devolve into heart failure due to an inability to meet the energetic demand required to maintain myosin overactivation and increased size of the myocardium. Note that a limitation of this study is the echocardiographic evaluation of heart function in only male animals.
This study identifies titin’s previously uncharacterized P-zone domains A164–167 as critical determinants of thick filament organization and function. Using the TtnΔA164–167 mouse model, we demonstrated that loss of these domains disrupts the spatial arrangement of titin and cMyBP-C in the thick filament, shortens thick filament length, and eliminates titin’s α and β conformations, resulting in a new titin structural state in the P-zone. These structural rearrangements led to functional consequences in both cardiac and skeletal muscle. We propose that these changes arise from perturbation of the fine-tuned structural relationship among thick filament proteins, compounded by compensatory adaptations. Mechanistically, the data support a model in which deletion of domains A164–167 eliminates a myosin repeat (three crowns, nine molecules) in each half-thick filament, specifically crowns P1, P2, and P3, resulting in P-zone disorganization. At the start of the C-zone, alignment between thick filament components is re-established. The loss of the titin β conformation further implicates domains A164–167, and the β loop in particular, as essential templating or stabilizing factors for thick filament assembly near the M-band. Together, these findings establish titin domains A164–167 as elements critical for the structure and function of the thick filament.
Data availability
The data underlying Fig. 1, C and D; and Fig. 2, A and C, are openly available in BioProject (Accession ID PRJNA1412858). All other data are available in the published article and its online supplemental material. Raw data are available upon request.
Acknowledgments
Olaf S. Andersen served as editor.
We thank Teodora Georgieva, PhD, director of the Bio5 ORP GEMM Core Facility at the University of Arizona for the generation of the TtnΔA164–167 mouse model; Douglas Cromey, MS, comanager of the ORP Imaging Core—Optical (RRID: SCR_023355) at the University of Arizona for training and assistance with SR-SIM imaging; and Marloes van den Berg, MD, PhD, research scientist for the Small Animal Phenotyping Core Facility at the University of Arizona for echocardiography analysis. Electron microscopy was performed at the University of Arizona ORP Imaging Cores—Electron (RRID: SCR_023279) (P.T.), mass spectrometry was performed in the University of Arizona Quantitative Proteomics Laboratory (P.R.L.), and cardiac histological processing, sectioning, and staining were performed by the University of Arizona Cancer Center’s Tissue Acquisition and Cellular/Molecular Analysis Core Facility. We are grateful to Samantha Harris, PhD, for the cMyBP-C antibody.
This work was supported by the National Heart, Lung, and Blood Institute (NHLBI) grant 5R35HL144998-07 (H. Granzier), National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS) grant 5R01AR083233-03 (H. Granzier), Interdisciplinary Training in Cardiovascular Research grants T32HL007249-46 and T32HL007249-47 (C. Hoover Browne), and NIAMS grant F31AR085369 (C. Hoover Browne). Open Access funding was provided by the University of Arizona.
Author contributions: Catherine Hoover Browne: conceptualization, data curation, formal analysis, funding acquisition, investigation, methodology, project administration, validation, visualization, and writing—original draft, review, and editing. Seong-won Han: data curation, formal analysis, and writing—review and editing. Gerrie P. Farman: data curation, formal analysis, and writing—original draft, review, and editing. John E. Smith: conceptualization, investigation, methodology, supervision, and writing—review and editing. Justin Kolb: investigation, project administration, and writing—review and editing. Jochen Gohlke: data curation, formal analysis, methodology, resources, software, and writing—review and editing. Paul R. Langlais: data curation, formal analysis, and writing—original draft, review, and editing. Paola Tonino: investigation, methodology, resources, validation, and writing—original draft, review, and editing. Mei Methawasin: investigation and writing—review and editing. Robbert van der Pijl: conceptualization, project administration, supervision, and writing—review and editing. Henk Granzier: conceptualization, funding acquisition, project administration, resources, supervision, and writing—review and editing.
References
Author notes
Disclosures: The authors declare no competing interests exist.

