The pre-B cell receptor is a key checkpoint regulator in developing B cells. Early events that are controlled by the pre-B cell receptor include positive selection for cells express membrane immunoglobulin heavy chains and negative selection against cells expressing truncated immunoglobulins that lack a complete variable region (Dμ). Positive selection is known to be mediated by membrane immunoglobulin heavy chains through Igα-Igβ, whereas the mechanism for counterselection against Dμ has not been determined. We have examined the role of the Igα-Igβ signal transducers in counterselection against Dμ using mice that lack Igβ. We found that Dμ expression is not selected against in developing B cells in Igβ mutant mice. Thus, the molecular mechanism for counterselection against Dμ in pre-B cells resembles positive selection in that it requires interaction between mDμ and Igα-Igβ.

The object of B lymphocyte development is to produce cells with a diverse group of clonally restricted antigen receptors that are not self reactive (1). Antigen receptor diversification is achieved through regulated genomic rearrangements that result in the random assembly of Ig gene segments into productive transcription units (2, 3). These gene rearrangements are in large part regulated by the preB cell receptor (BCR)1.

B cells undergoing Ig heavy chain gene rearrangements (pre-B) can express at least two types of BCRs. One form of the receptor is composed of membrane immunoglobulin heavy chain (mIgμ), λ5, V–pre-B, and Igα-Igβ, and is referred to as the pre-BCR (46). A second form of the preB cell receptor, known as the Dμ pre-BCR (7), is found only in pre-B1 cells (8) and contains truncated mIgμ chains lacking a VH domain (mDμ). mDμ is produced by Ig genes that have rearranged DJH gene segments in reading frame (RF) 2 producing an in-frame start codon and a truncated transcription unit (7). Like authentic mIgμ, mDμ is a membrane protein that forms a complex with λ5, V–pre-B, and Igα-Igβ, and in tissue culture cell lines the Dμ pre-BCR can activate cellular signaling responses (914). But despite its ability to activate nonreceptor tyrosine kinases, Dμ preBCR producing pre-B cells are selected against by a process that is mediated through the transmembrane domain of the mDμ protein (15). In contrast, pre-B cells that express intact mIgμ containing pre-BCRs are positively selected. Counterselection is reflected in the relative lack of mature B cells that express mIgμ in RF2 (1517). The mechanism by which mDμ activates counterselection has not been defined, but is known to require expression of syk (18). Here we report on experiments showing that Igβ is essential for counterselection against mDμ in vivo.

Materials And Methods

Mice.

Igβ−/−, mIgμ, and Bcl-2 transgenic strains have been previously described and were maintained by backcrossing with BALB/c mice under specific pathogen-free conditions (1921). All experiments were performed with 4–8-wk-old female mice.

Fluorescence Analysis and Cell Sorting.

Single cell suspensions prepared from bone marrow or spleen were stained with PE-labeled anti-B220 and FITC-labeled anti-CD43 (PharMingen, San Diego, CA) or FITC-labeled anti-IgM, and analyzed on a FACScan®. For cell sorting, bone marrow cells from four to six mice were stained with the same reagents and separated on a FACSvantage®. CD43+B220 and CD43+B220+ cells were collected based on gating with RAG-1−/− controls.

DNA and PCR.

Total bone marrow DNA was prepared for PCR as previously described (22). DNA from sorted cells was prepared for PCR in agarose plugs (23). Primers for VH–DJH and DH–JH rearrangement were as in reference 22; these primers are mouse specific and do not detect the human Igμ transgene. All experiments were performed a minimum of three times with two independently derived DNA samples. Nonrearranging Ig gene intervening sequences were amplified in parallel with other reactions and used as a loading control (22). Amplified DNA was visualized after transfer to nylon membranes by hybridization with a 6-kb EcoR1 fragment that spans the mouse JH region.

Isolation and Sequencing of VH–DJH and DH–JH Joints.

A JH4 primer was combined with either a DH primer or a VHJ558L primer to amplify DJH and VDJH rearrangements, respectively. The primers were: (a) JH4, ACGGATCCGGTGACTGAGGTTCCT; (b) DH, ACAAGCTTCAAAGCACAATGCCTGGCT; and (c) VHJ558L, GCGAAGCTTA(A,G)GCCTGGG(A,G)CTTCAGTGAAG. PCR amplification for DJH joints was for 35 cycles of 0.5 min at 94°C, and 2 min at 72°C; for VDJH joints, it was for 0.5 min at 94°C, 1 min at 68°C, and 1.5 min at 72°C. PCR products were purified by agarose gel electrophoresis, subcloned into pBluescript, sequenced using an Applied Biosystems (Foster City, CA) DNA sequencing kit, and analyzed on a genetic analyzer (ABI-310; Applied Biosystems).

Results

mIgM Cannot Induce the Pre-B Cell Transition or Allelic Exclusion in the Absence of Igβ.

Expression of Igβ is required for B cells to efficiently complete Ig VH to DJH gene rearrangements (19). B cells in Igβ−/− mice fail to express normal levels of mIgμ, and B cell development is arrested at the CD43+B220+ pre-B1 stage (19). A similar celltype specific developmental arrest is also found in mice that carry a mutation in the transmembrane domain of mIgμ (24), and mice that fail to complete Ig V(D)J recombination (2529). In view of the abnormally low levels of mIgμ in Igβ−/− mice, failed pre-B cell development might simply be due to lack of Ig expression.

To determine whether mIgμ could induce the pre-B cell transition in the absence of Igβ, we introduced a productively rearranged immunoglobulin gene (20) into the Igβ−/− background (TG.mμ Igβ−/−). We then measured B cell development by staining bone marrow cells with antiCD43 and anti-B220 monoclonal antibodies (30). We found that expression of a pre-rearranged Ig transgene was not sufficient to activate the pre-B cell transition in the absence of Igβ (Fig. 1). TG.mμ Igβ−/− B cells did not develop past the CD43+B220+ pre-B cell stage (Fig. 1). In control experiments, the same mIgμ transgene did induce the appearance of more mature CD43B220+ pre-B cells in a RAG−/− mutant background where B cell development was similarly arrested at the CD43+B220+ stage (20, 25, 26; data not shown). We conclude that in the absence of Igβ, a productively rearranged mIgμ is unable to activate the pre-B cell transition.

Allelic exclusion is established as early as the CD43+ B220+ stage of B cell development (3133). This early stage of development is found in the bone marrow of Igβ−/− mice (19). However, we were initially unable to measure allelic exclusion in Igβ mutant mice due to the low efficiency of complete Ig VH to DJH gene rearrangements and absence of surface Igμ expression (19). To determine whether expression of mIgμ could activate allelic exclusion in TG.mμ Igβ−/− mice, we measured inhibition of VH to DJH gene rearrangements by PCR (34). In controls, the mIgμ transgene inhibited VH to DJH gene rearrangement (22), but the same transgene had no effect in the Igβ−/− background (Fig. 2). We had previously shown that the cytoplasmic domains of Igα and Igβ are sufficient to activate allelic exclusion (20, 35). The finding that mIgμ is unable to induce allelic exclusion in the absence of Igβ suggests that Igβ is essential for allelic exclusion.

Igβ Is Required for RF2 Counterselection.

Igs with DH joined to JH in RF2 are rarely found in mature B cells (1517). Genetic experiments in mice have shown that counterselection against RF2 requires the transmembrane domain of mIgμ and the syk tyrosine kinase (15, 18). To determine whether counterselection is mediated through Igβ, we sequenced DJH joints amplified from sorted CD43+B220+ pre-B cells from Igβ−/− mice and controls. In control samples, only 10% of the DJH joints were in RF2 (Fig. 3), which is in agreement with similar measurements performed in other laboratories (1517, 3133). In contrast, there was no counterselection in the bone marrow cells of Igβ−/− mice; 13 out of 30 DJH joints were in RF2 with the remainder being distributed in RF1 and 3 (Fig. 3). Thus, in the absence of Igβ, there was no RF2 counterselection at the level of DJH rearrangements in CD43+B220+ cells in the bone marrow.

VH to DJH joining and counterselection are normally completed in CD43+B220+ pre-B cells (3133), but in Igβ−/− mice, VH to DJH joining is inefficient (19). To determine whether RF2 was counterselected in the few Igβ mutant B cells that completed VH to DJH rearrangements, we amplified and sequenced VHJ558L-DJH4 joints from unfractionated bone marrow cells (Fig. 4). As with the DJH joints, we found no evidence for counterselection against RF2 in VDJH joints in Igβ−/− B cells. 10/33 VHJ558LDJH4 joints sequenced from Igβ−/− mice were in RF2. By contrast, RF2 was only found in 1 of 11 mature Ig's in the controls. The VDJH and DJH Igβ−/− joints otherwise resembled the wild type in the number of N and P nucleotides as well as in the extent of nucleotide deletion (Figs. 3 and 4). We conclude that there was no selection against RF2 in the absence of Igβ, and that the absence of Igβ has no significant impact on the mechanics of recombination as measured by the variability of the joints.

Discussion

The transmembrane domain of mIgμ is required to produce the signals that mediate several antigen-independent events in developing B cells, including allelic exclusion and the pre-B cell transition (24, 3639). However, mIgμ itself is insufficient for signal transduction (40), and it requires the Igα and Igβ signaling proteins to activate B cell responses in vitro and in vivo.

The earliest developmental checkpoint regulated by IgαIgβ appears to involve either activation of cellular competence to complete VH to DJH rearrangements, or positive selection for cells that express mIgμ (19). In the next phase of the B cell pathway, the same transducers are necessary (Fig. 2) and sufficient to produce the signals that activate allelic exclusion and the pre-B cell transition (19, 20, 35, 41). In the present report, we show that in addition to these functions, Igα-Igβ transducers are also necessary for negative selection against Dμ.

Two models have been proposed to explain counterselection against mDμ. The first model states that mDμ is toxic, and that cells expressing this protein are deleted by a mechanism that involves inhibition of proliferation (31). A second theory postulates that Dμ proteins produce the signal for heavy chain allelic exclusion and block the completion of productive heavy chain gene rearrangements (15). According to this second model, cells expressing mDμ are then unable to continue along the B cell pathway. Support for the active signaling model comes from three sets of observations: (a) that there is no counterselection in the absence of a Igμ transmembrane exon (15); (b) that there is no RF counterselection in the absence of syk (18); and (c) that there is no counterselection in early CD43+B220+ B cell precursors in the absence of λ5 (33). These experiments partially define the receptor structure for counterselection as composed of mDμ associated with λ5. Our observation that negative selection against Dμ does not occur in the absence of Igβ supports the signaling model, and identifies Igα-Igβ as the transducers that activate counterselection possibly by linking mDμ to nonreceptor tyrosine kinases.

Why does the expression of the Dμ pre-BCR lead to arrested development, whereas mature mIgμ in the same complex activates positive selection in early B cells? Both signals are produced in CD43+B220+ pre-B cells, both require λ5 (33, 39, 42), and the Igα-Igβ coreceptors (19, 41), and both are transmitted through a cascade that induces syk (18, 43). One way to explain the difference between the cellular response to mDμ pre-BCR and mIgμ pre-BCR expression might be an inability of Dμ to pair with conventional κ or λ Ig light chains (14). According to this model, cells expressing mDμ should be trapped in the CD43B220+ preB cell compartment since B cell development can progress to the CD43B220+ stage in the absence of conventional light chains (44, 45). However, elegant single cell sorting experiments have shown that mDμ-producing cells are selected against before this stage in CD43+B220+ pre-B cells (33, 42). Thus, the idea that abnormal pairing of mDμ with light chains is responsible for counterselection fails to take into account the observation that counterselection normally occurs independently of light chain gene rearrangements.

Two alternative explanations for the disparate cellular responses to the Dμ pre-BCR and the mIgμ pre-BCR are: (a) that there are qualitative differences between signals generated by a mDμ and a mIgμ receptor complex, and (b) pre-B-I cells that contain DJH rearrangements are in a different stage of differentiation than pre-B-II cells that have completed VDJH and express mIgμ (8). An example of two qualitatively distinct signals resulting in alternative biologic responses has been found in the highly homologous TCR receptor (46, 47). TCR interaction with ligand can produce either anergy or activation, depending on the affinity of the TCR for the peptide-MHC complex (48). High affinity ligands that produce T cell responses fully activate CD3 tyrosine phosphorylation, whereas peptides that induce anergy bind with low affinity and induce a reduced level of CD3 phosphorylation. The low level CD3 phosphorylation induced by the anergizing peptides is associated with less than optimal ZAP-70 kinase activation (46, 47).

Less is known about the physiologic responses activated by Igα-Igβ in developing B cells, but experiments in transgenic mice have shown that early B cell development requires tyrosine phosphorylation of Igβ (20), and by inference, receptor cross-linking. Although the cytoplasmic domains Igα and Igβ appear to have redundant functions in allelic exclusion and the pre-B cell transition (20, 35), neither Igα, (41) nor Igβ (Papavasiliou, N., and M.C. Nussenzweig, manuscript in preparation) alone are able to fully restore B cell development in the bone marrow, suggesting that there are specific functions for Igα and Igβ, or the IgαIgβ heterodimer. Biochemical support for the idea that individual coreceptors could have unique biologic functions also comes from transfection experiments in B cell lines (4951) and from the observation that the cytoplasmic domains of Igα and Igβ bind to different sets of nonreceptor tyrosine kinases (52).

We would like to propose that positive and negative selection in developing B cells, like activation and anergy in T cells, may be mediated by differential phosphorylation of Igα and Igβ in the pre-BCR. Given the requirement for cross-linking in pre-BCR activation, the mechanism that produces the proposed differential phosphorylation of the mDμ and mIgμ pre-BCRs may be a function of their affinities for the cross-linker.

Acknowledgments

We thank members of the Nussenzweig laboratory for their helpful suggestions and advice.

References

References
1
Rajewsky
K
Clonal selection and learning in the antibody system
Nature (Lond)
1996
381
751
758
[PubMed]
2
Tonegawa
S
Somatic generation of antibody diversity
Nature (Lond)
1983
302
575
581
[PubMed]
3
Alt
FW
,
Yancopoulos
GD
,
Blackwell
KT
,
Wood
E
,
Boss
M
,
Coffman
R
,
Rosenberg
N
,
Tonegawa
S
,
Baltimore
D
Ordered rearrangements of immunoglobulin heavy chain variable region segments
EMBO (Eur Mol Biol Organ) J
1984
3
1209
1219
[PubMed]
4
Pillai
S
,
Baltimore
D
Formation of disulfide linked μ2ω2 tetramers by the 18 KD ω-immunoglobulin light chain
Nature (Lond)
1987
329
172
174
[PubMed]
5
Karasuyama
H
,
Kudo
A
,
Melchers
F
The proteins encoded by V pre-B and λ5 pre–B cell specific genes can associate with each other and with μ heavy chain
J Exp Med
1990
172
969
972
[PubMed]
6
Tsubata
T
,
Reth
MG
The products of the pre–B cell specific genes (λ5 and V pre-B) and the immunoglobulin μ chain form a complex that is transported to the cell surface
J Exp Med
1990
172
973
976
[PubMed]
7
Reth
MG
,
Alt
FW
Novel immunoglobulin heavy chains are produced from DJHgene segment rearrangements in lymphoid cells
Nature (Lond)
1984
312
418
423
[PubMed]
8
Rolink
A
,
Melchers
F
Molecular and cellular origins of B lymphocyte diversity
Cell
1991
66
1081
1094
[PubMed]
9
Nomura
J
,
Matsuo
T
,
Kubola
F
,
Kimoto
M
,
Sakaguchi
N
Signal transmission through the B cell specific MB-1 molecule at the pre–B cell stage
Int Immunol
1991
3
117
126
[PubMed]
10
Misener
V
,
Downey
GP
,
Jongstra
J
The immunoglobulin light chain related protein λ5 is expressed on the surface of pre–B cell lines and can function as a signaling molecule
Int Immunol
1991
3
1
8
[PubMed]
11
Takemori
T
,
Mizuguchi
J
,
Miyazoe
I
,
Nakanishi
M
,
Shigemoto
K
,
Kimoto
H
,
Shirasawa
T
,
Maruyama
N
,
Taniguchi
M
Two types of μ chain complexes are expressed during differentiation from pre–B to mature B cells
EMBO (Eur Mol Biol Organ) J
1990
9
2493
2500
[PubMed]
12
Tsubata
T
,
Tsubata
R
,
Reth
MG
Cross-linking of the cell surface immunoglobulin (μ surrogate light chain complex) on pre–B cells induces activation of V gene rearrangements at the immunoglobulin κ locus
Int Immunol
1992
4
637
641
[PubMed]
13
Tsutsumi
A
,
Terajima
J
,
Jung
W
,
Ransom
J
Surface μ heavy chain expressed on pre–B lymphomas transduces Ca++signals but fails to cause arrest of pre–B cell lymphomas
Cell Immunol
1992
139
44
57
[PubMed]
14
Horne
MC
,
Roth
PE
,
DeFranco
AL
Assembly of the truncated immunoglobulin heavy chain Dμ into antigen receptor-like complexes in pre–B cells but not in B cells
Immunity
1996
4
145
158
[PubMed]
15
Gu
H
,
Kitamura
D
,
Rajewsky
K
B cell development regulated by gene rearrangement: arrest of maturation by membrane-bound Dμ protein and selection of DHelement reading frames
Cell
1991
65
47
54
[PubMed]
16
Meek
K
Analysis of junctional diversity during B lymphocyte development
Science (Wash DC)
1990
250
820
823
[PubMed]
17
Kaartinen
M
,
Makela
O
Reading of D genes in variable frames as a source of antibody diversity
Immunol Today
1985
6
324
330
18
Cheng
AM
,
Rowley
B
,
Pao
W
,
Hayday
A
,
Bolen
JB
,
Pawson
T
Syk tyrosine kinase required for mouse viability and B cell development
Nature (Lond)
1995
378
303
306
[PubMed]
19
Gong
S
,
Nussenzweig
MC
Regulation of an early developmental checkpoint in the B cell pathway by Igβ
Science (Wash DC)
1996
272
411
414
[PubMed]
20
Papavasiliou
F
,
Misulovin
Z
,
Suh
H
,
Nussenzweig
MC
The role of Igβ in precursor B cell transition and allelic exclusion
Science (Wash DC)
1995
268
408
411
[PubMed]
21
Vaux
DL
,
Cory
S
,
Adams
J
Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre–B cells
Nature (Lond)
1988
335
440
442
[PubMed]
22
Costa
TEF
,
Suh
H
,
Nussenzweig
MC
Chromosomal position of rearranging gene segments influences allelic exclusion in transgenic mice
Proc Natl Acad Sci USA
1992
89
2205
2208
[PubMed]
23
Petree
HP
,
Livak
F
,
Burtrum
D
,
Mazel
S
T cell receptor gene recombination patterns and mechanisms: cell death, rescue, and T cell production
J Exp Med
1995
182
121
127
[PubMed]
24
Kitamura
D
,
Roes
J
,
Kuhn
R
,
Rajewsky
K
A B cell deficient mouse by targeted disruption of the membrane exons of the immunoglobulin μ chain gene
Nature (Lond)
1991
350
423
426
[PubMed]
25
Mombaerts
P
,
Iacomini
J
,
Johnson
RS
,
Herrup
K
,
Tonegawa
S
,
Papaioannou
VE
RAG-1 deficient mice have no mature B and T lymphocytes
Cell
1992
68
869
877
[PubMed]
26
Shinkai
Y
,
Rathbun
G
,
Lam
K-P
,
Oltz
EM
,
Stewart
V
,
Mendelsohn
M
,
Charron
J
,
Datta
M
,
Young
F
,
Stall
AM
,
Alt
FW
RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement
Cell
1992
68
855
867
[PubMed]
27
Ehlich
A
,
Schaal
S
,
Gu
H
,
Kitamura
D
,
Muller
W
,
Rajewsky
K
Immunoglobulin heavy and light chain genes rearrange independently at early stages of B cell development
Cell
1993
72
695
704
[PubMed]
28
Nussenzweig
A
,
Chen
C
,
Soares
V
,
Sanchez
M
,
Sokol
K
,
Nussenzweig
MC
,
Li
GC
Requirement for Ku80 in growth and immunoglobulin V(D)J recombination
Nature (Lond)
1996
383
551
555
[PubMed]
29
Zhu
C
,
Bogue
MA
,
Lim
D
,
Hasty
P
,
Roth
DB
Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates
Cell
1996
86
379
389
[PubMed]
30
Hardy
RR
,
Carmack
CE
,
Shinton
SA
,
Kemp
JD
,
Hayakawa
K
Resolution and characterization of proB and pre–pro-B cell stages in normal mouse bone marrow
J Exp Med
1991
173
1213
1225
[PubMed]
31
Haasner
D
,
Rolink
A
,
Melchers
F
Influence of surrogate light chain on DHJH-reading frame 2 suppression in mouse precursor B cells
Int Immunol
1994
6
21
30
[PubMed]
32
Ehlich
A
,
Martin
V
,
Muller
W
,
Rajewsky
K
Analysis of the B cell progenitor compartment at the level of single cells
Curr Biol
1994
4
573
583
[PubMed]
33
Loffert
D
,
Ehlich
A
,
Muller
W
,
Rajewsky
K
Surrogate light chain expression is required to establish immunoglobulin heavy chain allelic exclusion during early B cell development
Immunity
1996
4
133
144
[PubMed]
34
Schlissel
MS
,
Corcoran
LM
,
Baltimore
D
Virus-transformed pre–B cells show ordered activation but not inactivation of immunoglobulin gene rearrangement and transcription
J Exp Med
1991
173
711
720
[PubMed]
35
Papavasiliou
F
,
Jancovic
M
,
Suh
H
,
Nussenzweig
MC
The cytoplasmic domains of Igα and Igβ can independently induce the pre–B cell transition and allelic exclusion
J Exp Med
1995
182
1389
1394
[PubMed]
36
Nussenzweig
MC
,
Schmidt
EV
,
Shaw
AC
,
Sinn
E
,
Campos-Torres
J
,
Mathew-Prevot
B
,
Pattengale
PK
,
Leder
P
A human immunoglobulin gene reduces the incidence of lymphomas in c-Myc–bearing transgenic mice
Nature (Lond)
1988
336
446
450
[PubMed]
37
Nussenzweig
MC
,
Shaw
AC
,
Sinn
E
,
Danner
DB
,
Holmes
KL
,
Morse
HC
,
Leder
P
Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin μ
Science (Wash DC)
1987
236
816
819
[PubMed]
38
Manz
J
,
Denis
K
,
Witte
O
,
Brinster
R
,
Storb
U
Feedback inhibition of immunoglobulin gene rearrangement by membrane mu, but not by secreted mu heavy chains (erratum published 169:2269)
J Exp Med
1988
168
1363
1381
[PubMed]
39
Kitamura
D
,
Rajewsky
K
Targeted disruption of mu chain membrane exon causes loss of heavy-chain allelic exclusion
Nature (Lond)
1992
356
154
156
[PubMed]
40
Costa
TE
,
Franke
RR
,
Sanchez
M
,
Misulovin
Z
,
Nussenzweig
MC
Functional reconstitution of an immunoglobulin antigen receptor in T cells
J Exp Med
1992
175
1669
1676
[PubMed]
41
Torres
RM
,
Flaswinkiel
H
,
Reth
M
,
Rajewsky
K
Aberrant B cell development and immune response in mice with a compromised BCR complex
Science (Wash DC)
1996
272
1804
1808
[PubMed]
42
Loffert
D
,
Schaal
S
,
Ehlich
A
,
Hardy
RR
,
Zou
YR
,
Muller
W
,
Rajewsky
R
Early B-cell development in the mouse: insights from mutations introduced by gene targeting
Immunol Rev
1994
137
135
153
[PubMed]
43
Turner
M
,
Mee
PJ
,
Costello
PS
,
Williams
O
,
Price
AA
,
Duddy
LP
,
Furlong
MT
,
Geahlen
RL
,
Tybulewicz
VL
Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk
Nature (Lond)
1995
378
298
302
[PubMed]
44
Spanopoulou
E
,
Roman
CAJ
,
Corcoran
LM
,
Schlissel
MS
,
Silver
DP
,
Nemazee
D
,
Nussenzweig
MC
,
Shinton
SA
,
Hardy
RR
,
Baltimore
D
Functional immunoglobulin transgenes guide ordered B-cell differentiation in Rag-1–deficient mice
Genes Dev
1994
8
1030
1042
[PubMed]
45
Young
F
,
Ardman
B
,
Shinkai
Y
,
Lansford
R
,
Blackwell
TK
,
Mendelsohn
M
,
Rolink
A
,
Melchers
F
,
Alt
FW
Influence of Immunoglobulin heavy- and light-chain expression on B-cell differentiation
Genes Dev
1994
8
1043
1057
[PubMed]
46
Sloan-Lancaster
J
,
Shaw
AS
,
Rothbard
JB
,
Allen
PM
Partial T cell signaling: altered phospho-zeta and lack of zap-70 recruitment in APL induced T cell anergy
Cell
1994
79
913
922
[PubMed]
47
Madrenas
J
,
Wange
RL
,
Wang
JL
,
Isakov
N
,
Samelson
LE
,
Germain
RN
Zeta phosphorylation without ZAP-70 activation induced by TCR antagonists or partial agonists
Science (Wash DC)
1995
267
515
518
[PubMed]
48
Lyons
DS
,
Lieberman
SA
,
Hampl
J
,
Boniface
JJ
,
Chien
Y
,
Berg
LJ
,
Davis
MM
A TCR binds to antagonist ligands with lower affinities and faster dissociation rates than to agonists
Immunity
1996
5
53
61
[PubMed]
49
Kim
K-M
,
Alber
G
,
Weiser
P
,
Reth
M
Differential signaling through the Ig-α and Ig-β components of the B cell antigen receptor
Eur J Immunol
1993
23
911
916
[PubMed]
50
Sanchez
M
,
Misulovin
Z
,
Burkhardt
AL
,
Mahajan
S
,
Costa
T
,
Franke
R
,
Bolen
JB
,
Nussenzweig
M
Signal transduction by immunoglobulin is mediated through Igα and Igβ
J Exp Med
1993
178
1049
1056
[PubMed]
51
Luisiri
P
,
Lee
YJ
,
Eisfelder
BJ
,
Clark
MR
Cooperativity and segregation of function within the Ig-alpha/ beta heterodimer of the B cell antigen receptor complex
J Biol Chem
1996
271
5158
5163
[PubMed]
52
Clark
MR
,
Campbell
KS
,
Kazlauskas
A
,
Johnson
SA
,
Hertz
M
,
Potter
TA
,
Pleiman
C
,
Cambier
JC
The B cell antigen receptor complex: association of Ig-alpha and Ig-beta with distinct cytoplasmic effectors
Science (Wash DC)
1992
258
123
126
[PubMed]

This work was supported by the Howard Hughes Medical Institute, and by National Institutes of Health grants to Dr. Nussenzweig.

1Abbreviations used in this paper: BCR, B cell receptor; mIgμ, membrane immunoglobulin heavy chain; RF, reading frame.

Author notes

Address correspondence to Dr. Michel Nussenzweig, The Rockefeller University, Howard Hughes Medical Institute, 1230 York Ave., New York, NY 10021.