The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells

Address all correspondence to Dr. Ching-Hwa Sung, Dyson Vision Research Institute, Cornell University Medical College, 1300 York Avenue, New York, NY 10021. Tel.: (212) 746-2291. Fax: (212) 746-8101. E-mail: [email protected]

2. Multiple-step constructions were carried out to generate the plasmid pDB-Rho39Tr. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5′CGGAATTCCGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5′-ATGCTCTAGAAGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct. The rhodopsin sequence and its flanking restriction sites were then amplified from the maltose binding protein–Rho39 fusion construct (forward: 5′-GGTCGTCAGACTGTCGATGAAGCC; reverse: 5′-AATGTACAGCCGGGGCCACCTGGCTCG), digested with SacI/BsrGI, and ligated into SacI/Acc65I-digested maltose binding protein–Rho39 to generate a maltose binding protein–Rho39Di construct. This procedure was repeated once more to transfer another rhodopsin PCR fragment into SacI/Acc65I-digested maltose binding protein–Rho39Di construct to generate maltose binding protein–Rho39Tr construct. Finally, a PCR fragment containing the coding sequences for a triple repeat of rhodopsin's terminal 39 residues was amplified using maltose binding protein– Rho39Tr as a template (forward: 5′-CATGCCATGGCCAGCGGTCGTCAGACTGTCG; reverse: 5′-GTTGTAAAACGACGGCCAGTGCC) and subcloned into a NcoI/SalI-digested pAS2 vector (CLONTECH Labs, Palo Alto, CA) to obtain pDB-Rho39Tr. All inserts generated by PCR reactions were sequenced to confirm.