All basolateral sorting signals described to date reside in the cytoplasmic domain of proteins, whereas apical targeting motifs have been found to be lumenal. In this report, we demonstrate that wild-type rhodopsin is targeted to the apical plasma membrane via the TGN upon expression in polarized epithelial MDCK cells. Truncated rhodopsin with a deletion of 32 COOH-terminal residues shows a nonpolar steady-state distribution. Addition of the COOH-terminal 39 residues of rhodopsin redirects the basolateral membrane protein CD7 to the apical membrane. Fusion of rhodopsin's cytoplasmic tail to a cytosolic protein glutathione S-transferase (GST) also targets this fusion protein (GST–Rho39Tr) to the apical membrane. The targeting of GST–Rho39Tr requires both the terminal 39 amino acids and the palmitoylation membrane anchor signal provided by the rhodopsin sequence. The apical transport of GST–Rho39Tr can be reversibly blocked at the Golgi complex by low temperature and can be altered by brefeldin A treatment. This indicates that the membrane-associated GST–Rho39Tr protein may be sorted along a yet unidentified pathway that is similar to the secretory pathway in polarized MDCK cells. We conclude that the COOH-terminal tail of rhodopsin contains a novel cytoplasmic apical sorting determinant. This finding further indicates that cytoplasmic sorting machinery may exist in MDCK cells for some apically targeted proteins, analogous to that described for basolaterally targeted proteins.
The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells
Address all correspondence to Dr. Ching-Hwa Sung, Dyson Vision Research Institute, Cornell University Medical College, 1300 York Avenue, New York, NY 10021. Tel.: (212) 746-2291. Fax: (212) 746-8101. E-mail: [email protected]
2. Multiple-step constructions were carried out to generate the plasmid pDB-Rho39Tr. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5′CGGAATTCCGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5′-ATGCTCTAGAAGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct. The rhodopsin sequence and its flanking restriction sites were then amplified from the maltose binding protein–Rho39 fusion construct (forward: 5′-GGTCGTCAGACTGTCGATGAAGCC; reverse: 5′-AATGTACAGCCGGGGCCACCTGGCTCG), digested with SacI/BsrGI, and ligated into SacI/Acc65I-digested maltose binding protein–Rho39 to generate a maltose binding protein–Rho39Di construct. This procedure was repeated once more to transfer another rhodopsin PCR fragment into SacI/Acc65I-digested maltose binding protein–Rho39Di construct to generate maltose binding protein–Rho39Tr construct. Finally, a PCR fragment containing the coding sequences for a triple repeat of rhodopsin's terminal 39 residues was amplified using maltose binding protein– Rho39Tr as a template (forward: 5′-CATGCCATGGCCAGCGGTCGTCAGACTGTCG; reverse: 5′-GTTGTAAAACGACGGCCAGTGCC) and subcloned into a NcoI/SalI-digested pAS2 vector (CLONTECH Labs, Palo Alto, CA) to obtain pDB-Rho39Tr. All inserts generated by PCR reactions were sequenced to confirm.
Jen-Zen Chuang, Ching-Hwa Sung; The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells . J Cell Biol 7 September 1998; 142 (5): 1245–1256. doi: https://doi.org/10.1083/jcb.142.5.1245
Download citation file:
Sign in
Suggested Content
Email alerts
Advertisement
