Abstract. Vascular endothelial growth factor (VEGF) is an important regulator of vasculogenesis, angiogenesis, and vascular permeability. In contrast to its transient expression during the formation of new blood vessels, VEGF and its receptors are continuously and highly expressed in some adult tissues, such as the kidney glomerulus and choroid plexus. This suggests that VEGF produced by the epithelial cells of these tissues might be involved in the induction or maintenance of fenestrations in adjacent endothelial cells expressing the VEGF receptors. Here we describe a defined in vitro culture system where fenestrae formation was induced in adrenal cortex capillary endothelial cells by VEGF, but not by fibroblast growth factor. A strong induction of endothelial fenestrations was observed in cocultures of endothelial cells with choroid plexus epithelial cells, or mammary epithelial cells stably transfected with cDNAs for VEGF 120 or 164, but not with untransfected cells. These results demonstrate that, in these cocultures, VEGF is sufficient to induce fenestrations in vitro. Identical results were achieved when the epithelial cells were replaced by an epithelial-derived basal lamina-type extracellular matrix, but not with collagen alone. In this defined system, VEGF-mediated induction of fenestrae was always accompanied by an increase in the number of fused diaphragmed caveolae-like vesicles. Caveolae, but not fenestrae, were labeled with a caveolin-1–specific antibody both in vivo and in vitro. VEGF stimulation led to VEGF receptor tyrosine phosphorylation, but no change in the distribution, phosphorylation, or protein level of caveolin-1 was observed. We conclude that VEGF in the presence of a basal lamina-type extracellular matrix specifically induces fenestrations in endothelial cells. This defined in vitro system will allow further study of the signaling mechanisms involved in fenestrae formation, modification of caveolae, and vascular permeability.

Fenestrae are specialized plasma membrane microdomains in endothelial cells that are involved in vascular permeability. They appear as circular discontinuities of ∼60 nm in diameter and usually occur in clusters in the most attenuated regions of the endothelial cell (for review see Palade et al., 1979). Fenestrated endothelia are found in endocrine organs, the gastrointestinal tract, kidney glomeruli, and specific regions of the brain, such as choroid plexus, and circumventricular organs, as well as in many tumors (Rhodin, 1974; Coomber et al., 1987, 1988; Shibata, 1989; Roberts and Palade, 1997). In contrast, endothelial cells found within connective tissues, muscle, skin, lung, and brain generally do not possess fenestrations. The molecular basis for this phenotypic diversity of endothelial cells is not known (Risau, 1995).

Previous in vitro studies aimed to identify factors involved in fenestrae formation reported that extracellular signals (e.g., TGFβ, retinoic acid, serotonin), the tumor promotor phorbol myristate acetate (PMA)1, the actin-disrupting agent cytochalasin B, and calcium ions, as well as extracellular matrix components, have some effect on fenestrae formation (Milici et al., 1985; Lombardi et al., 1986, 1988; Steffan et al., 1987; Carley et al., 1988; McGuire et al., 1992; Gatmaitan et al., 1996). However, the relevance of these factors in fenestrae induction under physiological conditions in vivo is not known. In addition, no molecular markers are available to detect the fenestrated phenotype in rapid screening assays.

Vascular endothelial growth factor (VEGF), which exists in several alternative splice variants (Tischer et al., 1991; Breier et al., 1992; Poltorak et al., 1997), is not only an endothelial growth factor but was initially characterized as a vascular permeability factor secreted by tumor cells (Senger et al., 1983; Keck et al., 1989). We have previously shown that VEGF is continuously expressed in epithelial cells of adult organs with fenestrated endothelium, such as choroid plexus and kidney glomeruli (Breier et al., 1992). Also, the persistent expression of mRNA for the corresponding VEGF receptors-1 and -2 in endothelial cells of these organs has been described (Millauer et al., 1993; Breier et al., 1995; Simon et al., 1995). Since VEGF is highly expressed during embryonic vasculogenesis and angiogenesis, but is downregulated in most adult tissues when endothelial proliferation has ceased, we speculated that the continuous expression of VEGF might be involved in the induction or maintenance of endothelial fenestrations (Breier et al., 1992). Indeed, it has recently been shown that VEGF application in vivo directly and rapidly induced fenestrae in the continuous endothelium of skeletal muscle and skin (Roberts and Palade, 1995) and in the neovasculature of VEGF-secreting tumors (Roberts and Palade, 1997). Although these studies provide compelling evidence that VEGF is involved in fenestrae formation in vivo, in vitro model systems are required to characterize the molecular mechanisms by which VEGF induces fenestrae.

The exact mechanisms (e.g., transcellular versus paracellular) and structures (e.g., plasmalemmal vesicles versus cell–cell junctions) responsible for increased vascular permeability are still controversial (Jain, 1988; Dvorak et al., 1995; Roberts and Palade, 1997). Compelling evidence exists that caveolae are involved in transcytotic transport of solutes across the endothelium (Ghitescu et al., 1986; Predescu et al., 1994, Schnitzer et al., 1994). Caveolae (also termed plasmalemmal vesicles) are small invaginations at the cell surface that measure 50–100 nm in diameter and often surround fenestrae (Palade et al., 1979). It is known that fenestrae are highly permeable for water and small solutes (Levick and Smaje, 1987). Electron microscopic studies have shown that most fenestrae are spanned by a nonmembraneous diaphragm that is also found in caveolae and in fused clustered vesicles, also referred to as vesiculo-vacuolar organelles (VVOs; Dvorak et al., 1996). However, the exact structural and functional relationship between these vesicular structures remains unclear.

Caveolin is an integral membrane component of caveolae that is now generally accepted as a marker protein for this organelle. Caveolin (now termed caveolin-1) belongs to a multigene family of at least three different members: caveolin-1, -2, and -3 (Kurzchalia et al., 1992; Way and Parton, 1995; Scherer et al., 1996; Song et al., 1996; Tang et al., 1996). Two alternate start sites in the gene of caveolin-1 give rise to α and β isoforms (Scherer et al., 1995). The structurally homologous caveolin proteins show overlapping but distinct tissue distribution. Although caveolin-1 was found to be a critical component of the caveolar coat (Rothberg et al., 1992), its function is still unknown. Caveolae have been implicated in signal transduction (Anderson, 1993; Sargiacomo et al., 1993; Lisanti et al., 1994), transcytosis (Ghitescu et al., 1986; Predescu et al., 1994, Schnitzer et al., 1994), cholesterol transport (Murata et al., 1995; Smart et al., 1996), regulation of tissue factor (Mulder et al., 1996), and endothelial nitric oxide synthase function (Garcia-Cardena et al., 1996; Shaul et al., 1996); (for reviews see also Kurzchalia and Parton, 1996; Parton, 1996; Couet et al., 1997b). Despite the similarity between caveolae, VVOs, and fenestrae, no information has been available on the distribution of caveolin-1 in the latter two structures.

Here we report the establishment of a novel in vitro system for studying the conditions under which endothelial cells develop fenestrations in response to VEGF. Progressively better defined conditions show that VEGF induces a robust and consistent increase in the number of fenestrations and fused diaphragmed vesicles. This increase was accompanied by a decrease in labeling of fused vesicles and fenestrae for caveolin-1, a marker protein of plasmalemmal vesicles or caveolae. VEGF stimulation initiated receptor tyrosine phosphorylation and signal transduction in endothelial cells. However, no change in phosphorylation or protein levels of caveolin-1 was observed. Our data demonstrate that, under defined in vitro conditions, such as the presence of a basal lamina-type matrix, VEGF is sufficient to induce fenestrations in vitro.

Materials And Methods

Materials

Laboratory reagents were purchased from Sigma Chemical Co. (Deisenhofen, Germany) unless otherwise stated. Anti–caveolin-1 antibodies were described previously (Dupree et al., 1993) or were purchased from Santa Cruz Biotechnology, Inc. (C-20; Heidelberg, Germany) or Transduction Laboratories, (C13630; Exeter, UK). For staining of endothelial cells, a rabbit polyclonal antibody against von Willebrand factor (Dako Corp., Hamburg, Germany) or monoclonal antibodies against platelet endothelial cell adhesion molecule-1 (Mec 13.3; Vecchi et al., 1994) and endoglin (MJ 7/18; Ge et al., 1994) were used. Antiphosphoserine and anticytokeratin antibodies were purchased from Sigma Chemical Co. A rabbit polyclonal serum and a rat monoclonal antibody against flk-1 were gifts from H. App (SUGEN, Inc., Redwood City, CA), and S.-I. Nishikawa and H. Kataoke (Kyoto University, Kyoto, Japan), respectively. Antibodies against phosphotyrosine were obtained from Transduction Laboratories and the anti-VEGF antibody was prepared as previously described (Breier et al., 1992). As a control for equal protein loading on gels, a monoclonal anti-d-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody from Biogenesis (Poole, UK) was used. Peroxidase-conjugated secondary antibodies (reactive with either rabbit or mouse IgG) were from Pierce Chemical Co. (Rockford, IL) or Amersham Buchler GmbH (Braunschweig, Germany). For immunolabeling in light and electron microscopy, FITC, rhodamine, Cy-3, or gold-conjugated antibodies against rabbit, mouse, or rat IgG were obtained from The Jackson ImmunoResearch Laboratories (West Grove, PA), Amersham Buchler GmbH, or Aurion (BioTrend, Cologne, Germany). As negative controls for primary antibodies, unconjugated rabbit, rat, or mouse IgG from Sigma Chemical Co. and Vector Labs Inc. (Burlingame, CA) were included.

Cell Culture

Media and other cell culture reagents were obtained from Life Technologies, Inc. (Eggenstein, Germany). Cloned bovine adrenal cortex endothelial cells (ACE), a gift of J. Folkman (Harvard Medical School, Boston, MA); Folkman and Haudenschild, 1980) were used at passages 15–20. Stock cultures were grown on collagen-coated dishes (collagen G; Seromed, Berlin, Germany) in low glucose DME containing 10% donor calf serum (Sigma Chemical Co.). Choroid plexus epithelial cells were isolated from mice of embryonic day 12.5 (Stadler et al., 1994), cultured on laminin (Upstate Biotechnology Inc., Lake Placid, NY)-coated dishes, and then routinely checked for expression of cytokeratin by immunofluorescence microscopy. The mouse mammary epithelial cell lines overexpressing VEGF 120 or 164 were generated by calcium-phosphate transfection of EpH4 cells (Oft et al., 1996) with cytomegalovirus-based expression vectors (pRC/CMV; Invitrogen BV, Leek, The Netherlands) that contained the respective mouse VEGF cDNAs (Breier et al., 1992). Cell clones resistant to G418 (Life Technologies, Inc.) were selected and tested for secretion of the respective VEGF protein into the medium by immunoblot analysis as published (Breier et al., 1992). Preparation of extracellular matrix–coated dishes was performed essentially as described (Gospodarowicz, 1984). Cocultures were generated by simultaneously seeding epithelial cells and twice the number of endothelial cells on tissue culture plates that were either coated for 16 h at 4°C with laminin (cocultures with choroid plexus epithelial cells) or for 16 h at 37°C with collagen (cocultures with EpH4 cells). The cells were grown for ∼4–7 d in DME supplemented with 10% FCS (PAN Systems GmbH, Nuernberg, Germany) until the cultures had reached confluency. Human umbilical vein endothelial cells (HUVEC) were prepared by the method of Jaffe et al. (1973) as modified by Jarrell et al. (1984) and then cultured as described in detail elsewhere (Lampugnani et al., 1992). Human or murine recombinant VEGF was provided by H. Weich (Gesellschaft für Biotechnologische Forschung, Braunschweig, Germany), and human basic FGF was obtained from Boehringer Mannheim (Mannheim, Germany).

Electron Microscopy

Conventional Microscopy.

Confluent cell monolayers were washed with Hanks modified salt solution (HMSS), pH 7.4, and then fixed for 4 h in 2% glutaraldehyde (Polysciences Inc., Warrington, PA) in HMSS, pH 7.4, 4°C, followed by two washes in 0.2 M cacodylate buffer for 10 min each and then postfixed for 1 h in 1% OsO4. After washing, the cells were scraped from the dishes, centrifuged in buffer for 5 min, and then dehydrated by a graded ethanol series. En bloc staining was performed in 6% uranyl acetate/70% ethanol for ⩾1 h or overnight in the dark. Samples were embedded in Araldite (Serva, Heidelberg, Germany), sectioned with an ultramicrotome (model Ultracut R; Leica, Inc., St. Gallen, Switzerland) for electron microscopy, stained with lead citrate, and then examined in an electron microscope (model EM10; Carl Zeiss, Inc., Thornwood, NY). For morphometric analysis, thin sections were cut for each specimen from three levels at a distance of 30 μm. In every section, all profiles of ACE cells, fenestrations, and fused diaphragmed vesicles were counted. Clusters of diaphragmed vesicles, clusters of fenestrae, and isolated fenestrae were counted as single entities.

Immunoelectron Microscopy.

Cell cultures and mouse tissues were washed in HMSS buffer and fixed in the same buffer supplemented with 2% paraformaldehyde, 0.05% glutaraldehyde, pH 7.4, for 2 h at 4°C. After washing in PBS, the pellets obtained by centrifugation were enclosed in 2% agar, embedded in Lowicryl K4M resin (Polysciences, Inc., Eppelheim, Germany), and then polymerized at −35°C under UV light. Ultrathin sections were cut and mounted on nickel or copper grids and then immunolabeled. The sections were blocked for 30 min at room temperature with TBS containing 5% BSA, 0.1% cold-water fish skin gelatin, 5% normal serum, and 0.1% Tween-20 (Serva), and then incubated with polyclonal anti–caveolin-1 antibody (C13630; Transduction Laboratories), diluted 1:100 or 1:50 in incubation buffer: 0.8% BSA, 0.1% cold-water fish skin gelatin, 20 mM NaN3, 0.1% Tween-20 in TBS. As negative controls, the primary antibody was omitted or nonimmune rabbit IgG at the same concentration as the primary antibody were used. After washing six times in incubation buffer, incubation with secondary antibody (goat anti–rabbit conjugated with 6- or 15-nm gold particles, diluted 1:40 in incubation buffer) was performed. The sections were subsequently washed and postfixed in 2% buffered glutaraldehyde for 5 min. Finally, the grids were washed in distilled water, air-dried, and then poststained with 6% aqueous uranyl acetate and lead citrate for 2 min.

Indirect Immunofluorescence

Cryosections of mouse embryos or adult mouse organs were fixed for 10 min in ice-cold methanol, air-dried, and then blocked for 15 min in normal goat serum. The sections were incubated for 1 h with the respective primary antibodies, washed three times with PBS, and then incubated for another hour with the appropriate fluorophore-conjugated secondary antibody. After a final wash, the sections were mounted in Mowiol 4-88 (Calbiochem, Bad Soden, Germany). Cells cultured on tissue culture dishes, glass coverslips, or chamberslides (Nunc, Naperville, IL) were fixed for 10 min with ice-cold methanol (for cytokeratin- and endothelial-specific staining) or for 20 min with 3% paraformaldehyde (for caveolin-1 staining), followed by incubation with 50 mM NH4Cl for 10 min and permeabilization with 0.2% Triton X-100 for 10 min. The cells were then rinsed, blocked with normal goat serum, and immunostained as described above. As negative controls, unconjugated rabbit, rat, or mouse immunoglobulins were used at the same concentration as the respective primary antibodies. Fluorescence was examined with a Zeiss Axiophot or Axiovert microscope (model 135; Carl Zeiss, Inc.).

Immunoprecipitation

ACE cells were stimulated with VEGF, pervanadate, or PMA at 37°C as indicated, pretreated for 1 h with 1 mM vanadate before lysis, and then washed in PBS containing 1 mM vanadate. The cells were solubilized on ice for 20 min either in Triton buffer (150 mM NaCl, 10 mM Tris, pH 7.5, 1% Triton X-100) or in SDS lysis buffer (Dupree et al., 1993) supplemented with a cocktail of phosphatase and proteinase inhibitors (1 mM vanadate, 10 μg/ml pepstatin, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 1 mM PMSF). For serine-phosphorylation studies, buffers additionally contained 400 nM okadaic acid (Calbiochem) and 50 mM NaF. The cells were scraped from the culture dishes and then the lysates were centrifuged at 13,000 rpm for 10 min at 4°C to pellet cellular debris. The supernatant volume corresponding to the same number of cells was either subjected to immunoprecipitation or aliquots were removed and boiled for 5 min after addition of 4× sample buffer (Laemmli, 1970). Immunoprecipitations were performed with antibodies either preabsorbed to protein A– or G–Sepharose beads (Pharmacia, Freiburg, Germany) or the Sepharose was added to preformed antibody–antigen complexes. The Sepharose-bound immune complexes were washed four times with lysis buffer (containing protease and phosphatase inhibitors), once with the same buffers without detergent, and then boiled in reducing sample buffer.

Immunoblotting

Conditioned media from control and transfected epithelial cells were concentrated using MICROSEP™ microconcentrators (Filtron, Karlstein, Germany) and then mixed with sample buffer. Proteins of media, total cellular extracts, and immunoprecipitates were separated by SDS-PAGE in 7, 12.5, or 15% gels, transferred onto 0.2-μm pore size nitrocellulose membranes (Schleicher & Schuell, Inc., Dassel, Germany), blocked with 3% BSA in PBST (0.1% Tween-20 in PBS), and then incubated with primary and peroxidase-conjugated secondary antibodies with six washes of PBST after each incubation. Protein–antibody complexes were visualized using the enhanced chemiluminescence Western blot detection system (Amersham Buchler GmbH).

RNA Extraction and Reverse Transcription (RT)-PCR Analysis

Choroid plexus was dissected from bovine brain and then frozen at −80°C. Glomeruli isolated from mouse kidneys (Kurtz et al., 1982) were stored at −80°C until used. Total cytoplasmic RNA was isolated from these tissues using the guanidinium thiocyanate method (Chomczynski and Sacchi, 1987) and RT was performed essentially as described (Wizigmann-Voos et al., 1995) using the following synthetic oligonucleotide primers for amplification: (5′-oligonucleotide) 5′-d(GTGCTCTCTTGGGTGCACTGG), and (3′-oligonucleotide) 5′-d(CACCGCCTTGGCTTGTCACAT). As a positive control, cDNAs encoding VEGF 120, 164, and 188 (Breier et al., 1992) were used as templates for amplification; the cDNA template was omitted from the reaction as negative control. The amplification products were separated on 1.5% agarose gels and visualized by ethidium bromide staining.

Results

Expression of VEGF Isoforms in Organs with Fenestrated Endothelium

Since different isoforms of VEGF exist, it was conceivable that one particular isoform might possess the potential biological activity for induction of fenestrae. Therefore, we analyzed the expression pattern of VEGF isoforms in different adult organs using the RT-PCR technique. RNA from mouse heart, lung, kidney glomeruli, and bovine choroid plexus was extracted, reverse transcribed, and then amplified using different VEGF primer combinations. VEGF isoforms 164 and 120 were predominantly expressed in choroid plexus (Fig. 1, lane 3) and glomerulus (data not shown). In lung (Fig. 1, lane 2) and heart (data not shown), isoform 188 was also detectable. It appears, therefore, that the presence of VEGF in organs with fenestrated endothelium does not correlate with the predominant expression of a specific VEGF isoform, but may be related to a persistent VEGF expression in general.

Continuous Expression of VEGF and VEGF Receptors in Organs with Fenestrated Endothelium

We have previously shown by in situ hybridization studies of embryonic and adult mouse tissues that the expression of VEGF and its receptors is downregulated in most adult tissues (Breier et al., 1992; Millauer et al., 1993). In contrast, VEGF expression was found to be maintained at a high level in adult organs with fenestrated endothelium (Breier et al., 1992; Brown et al., 1992; Jakeman et al., 1992; Monacci et al., 1993; Simon et al., 1995). For example, the mRNA for VEGF and its receptors is highly expressed in the endothelial cells of embryonic and adult choroid plexus as well as kidney glomeruli. To study the requirements for endothelial fenestrations in vitro, we have examined the choroid plexus in more detail by immunofluorescence microscopy. We found that VEGF receptor-2 (flk-1) was expressed in endothelial cells of embryonic and adult choroid plexus (data not shown) also at the protein level. In addition, the endothelial, but not epithelial, cells of choroid plexus were recognized by antibodies against caveolin-1 (data not shown). This finding is notable because high expression of caveolin-1 protein was reported for endothelial as well as epithelial cells (Kurzchalia et al., 1992; Lisanti et al., 1994). Taken together, these observations suggested a paracrine role for VEGF expressed by epithelial cells in the induction or maintenance of fenestrations in the adjacent endothelial cells in these tissues.

Cocultures of Endothelial Cells with Choroid Plexus Epithelial Cells

We used an in vitro coculture system in which freshly isolated murine choroid plexus epithelial cells (CPE) were plated together with bovine ACE. These primary endothelial cells, which express the VEGF receptors-1 and -2 (Plouet and Moukadiri, 1990; Vaisman et al., 1990), are derived from capillaries that are fenestrated in vivo, but lose fenestrae in culture (Folkman and Haudenschild, 1980; Furie et al., 1984). Cocultures formed confluent monolayers in which each cell type tended to grow in isolated clusters, and these were in direct contact with each other at their border areas (Fig. 2, a and b). Cultures of each cell type and cocultures were stained with antibodies against cytokeratin and von Willebrand factor to label epithelial and endothelial cells, respectively. Cultures of primary CPE cells consisted of ∼70% cytokeratin-positive epithelial cells. No endothelial cells could be detected with antibodies against the endothelial-specific antigens von Willebrand factor, platelet endothelial cell adhesion molecule-1, and endoglin (data not shown). Electron microscopic analysis of ACE cells revealed intact cell–cell junctions and basal–apical polarity (Fig. 2,c). The spindle-like appearance of these cells also allowed their identification in coculture. Intercellular contact zones were visible as areas where either extremely thin processes joined each other or extensions of larger cytoplasmic areas overlapped. In orthograde sections through the middle of the cell (indicated by the nucleus), relatively few caveolae and vesicle clusters were attached to the membrane and no difference in their distribution between the apical and basal surface was observed. However, in the processes distant from the perikaryon, the density of caveolae was increased (Fig. 2,d). Many caveolae were observed to be covered by a structure reminiscent of a diaphragm. However, fenestrations themselves were rarely observed in ACE cells cultured alone. The most striking difference between ACE cells cultured alone and in cocultures was the appearance of fenestrations and an increase in the number of fused vesicles with diaphragms in the endothelial cells (Fig. 2,e). The fenestrations, which were predominantly found in extremely attenuated areas of the endothelial cell, displayed the typical appearance of fenestrae in vivo. They had a diameter of ∼60 nm and were bridged by a thin diaphragm, which sometimes contained a central knob (see also Fig. 4). We conclude that CPE cells are able to induce endothelial fenestrations in vitro. Since CPE cells produce VEGF in vivo, we asked whether VEGF itself, in an epithelial context, induces fenestrae.

Cocultures of Endothelial Cells with Stably Transfected Epithelial Cell Lines Overexpressing VEGF

To determine the direct effects of VEGF produced by epithelial cells on ACE cells, we used a mouse epithelial cell line (EpH4; Oft et al., 1996) that was stably transfected with either VEGF 164 or 120, as these were the two main isoforms found to be expressed in organs with fenestrated endothelium (refer to Fig. 1). Untransfected and VEGF-transfected epithelial cells displayed the typical cobblestone appearance of squamous epithelia with extensive tight junctions (data not shown). Immunoblot analysis of conditioned EpH4 media revealed that untransfected EpH4 cells exhibited only a very low basal expression of VEGF, whereas the transfected cell lines secreted high levels of the respective VEGF isoforms (Fig. 3,a). VEGF 120–transfected cells produced a higher amount of VEGF protein than VEGF 164–transfected cells (Fig. 3,a). The morphological appearance of the coculture was similar to the CPE/ACE cocultures, showing separate islands of tightly clustered cobblestone-shaped epithelial cells and spindle-shaped endothelial cells (Fig. 3, b and c). Growth of both epithelial and endothelial cells appeared to be accelerated in cocultures. Overexpression of VEGF by the transfected epithelial cells had a morphological effect on neighboring ACE cells, which was already visible at the light microscopic level. As illustrated in Fig. 3,c, ACE cells in cocultures with the transfected epithelial cells had a more elongated phenotype and developed small branches and sprouts, which were often concentrated in areas of endothelial cell islands close to epithelial cells. These were not observed in cocultures with untransfected cells. Electron microscopy of cocultures with transfected cells revealed an induction of fenestrae and a strong increase in the number of fused diaphragmed vesicles (Fig. 3, d–f). Frequently, fenestrae were found in thin processes of endothelial cells, thus resembling their appearance in vivo (Fig. 3,d). In addition, extremely thin cellular extensions enclosing an extracellular space or cellular process also exhibited numerous fenestrations (Fig. 3 f).

To quantify the effect of VEGF on ACE cells, a morphometric analysis was performed by counting the number of fenestrations and fused clustered vesicles with diaphragms and then expressing them in relation to the number of cellular profiles. Table I summarizes the quantitative effect of VEGF in cocultures of epithelial and endothelial cells. VEGF120-overexpressing EpH4 cells induced a seven- or eightfold increase in the number of fused clustered vesicles and fenestrae in ACE cells. The induction was less pronounced in cocultures with the VEGF 164–transfected cells, which may be attributed to the lower amount of VEGF secreted by this cell line. There was only a minor effect on fenestrae induction in cocultures with untransfected EpH4 cells compared to monocultures of ACE cells, which may be explained by the low basal expression of VEGF in control EpH4 cells. Taken together, these data demonstrate that VEGF induces an increase in the number of endothelial fenestrations and fused diaphragmed vesicles in vitro. In experiments where cocultures of transfected EpH4 cells with HUVEC instead of ACE cells were used, no effect was observed (data not shown).

Effect of Purified VEGF on Endothelial Cells Grown on Complex Extracellular Matrix

To test the possibility that additional factors produced by the epithelial cells synergize with VEGF in fenestrae induction, we further reduced the complexity of our in vitro system and tested the effect of purified VEGF on endothelial cells. Since the importance of a specific extracellular environment for fenestrae induction had been demonstrated (Milici et al., 1985; Carley et al., 1988; McGuire et al., 1992), we tested the contribution of different extracellular matrices to the effect of VEGF. We cultivated the endothelial cells either on rat tail collagen, which is a mixture of type I and III collagen, or on a basal lamina-type extracellular matrix produced by corneal endothelial cells. We then incubated the cells for various time periods with recombinant VEGF 165 using concentrations (50–100 ng/ml) known to maximally induce autophosphorylation of VEGF receptors (Waltenberger et al., 1994). Similar to the cocultures, purified VEGF induced an elongated endothelial phenotype and the appearance of cell sprouts, which were first visible after 6 h of incubation and were much more pronounced after a 24-h treatment (data not shown). Electron microscopical analysis of ACE cells cultured on basal lamina-type matrix and stimulated for 24 h with VEGF revealed an increase in the number of fused diaphragmed vesicles and fenestrations to a similar extent as in the cocultures (Fig. 4; Table II). ACE cells formed long thin cellular processes, which were interrupted by numerous fenestrations (Fig. 4, a and b). In addition, large clusters of fused vesicles were found, frequently separated only by thin diaphragms that often contained a central knob (Fig. 4,c). Incubation periods shorter than 24 h did not show an effect on fenestrae formation. Consistent with the coculture studies, VEGF induced fenestrae formation only two- or threefold in HUVEC cells cultivated on the matrix (data not shown). As a control for the extracellular matrix effect, parallel cultures of ACE cells were plated on rat tail collagen. VEGF treatment of cells under these conditions did not induce fused vesicles and fenestrations, whereas ACE cells cultured on the basal lamina-type matrix showed a 10-fold increase (Table II). Since basic FGF has also been reported to induce fenestrae in vivo (Roberts and Palade, 1997), we tested if it could replace VEGF in our in vitro system. However, incubation of ACE cells cultured on basal lamina-type matrix with basic FGF had only a minor effect on the number of fenestrations and fused diaphragmed vesicles (Table II). In conclusion, our data show that the effect of VEGF on fenestrae induction in vitro is specific. In addition, in the presence of a basal lamina-type matrix, VEGF is also sufficient for the induction of fenestrations in ACE cells in vitro.

Caveolae, but Not Fenestrae or Fused Diaphragmed Vesicles, Can Be Labeled with Antibodies against Caveolin-1

Since the induction of endothelial fenestrations by VEGF was always accompanied by an increase in the number of fused clustered caveolae-like vesicles with diaphragms, we wondered if caveolar proteins might be common molecular components of these structures. Ultrathin Lowicryl sections of paraformaldehyde-fixed material were labeled with an antibody against caveolin-1, a marker protein of caveolae. We first confirmed the specificity of our approach by in situ labeling of mouse muscle capillaries, which have continuous endothelia extremely rich in caveolae. As shown in Fig. 5,a, a considerable fraction of the caveolae were immunolabeled with the antibody. The labeling efficiency was increased in cryosections compared to resin sections (data not shown). No labeling was seen if the primary antibody was omitted or replaced by nonimmune rabbit immunoglobulins (Fig. 5,b). Caveolin-1–positive vesicles could also be identified in endothelial cells of the choroid plexus dissected from adult mouse brain (Fig. 5,c). In contrast, the fenestrae of these endothelial cells were always devoid of anti–caveolin-1 immunoreactivity (Fig. 5 c).

In vitro, we analyzed the cocultures of VEGF-transfected epithelial cells that had shown a strong induction of fenestrae and fused clustered vesicles. Fig. 5,d shows specific labeling of endothelial caveolae with anti–caveolin-1 antibodies in ACE cells. Specific labeling was only found in uncoated vesicles of apical or basal plasma membranes and was absent in control experiments when the first antibody was omitted. EpH4 cells revealed some immunopositive caveolae in their lateral membranes (data not shown). We never detected caveolin-1 in diaphragmed fenestrations (Fig. 5,f). Except for one gold particle, which may represent a recently fused caveola (Fig. 5 e), clustered diaphragmed vesicles were found to be immunonegative for caveolin-1.

Effects of VEGF on Caveolin-1 Expression and Phosphorylation in ACE Cells

Since caveolin-1 was detected in endothelial caveolae, but not in fused clustered vesicles or fenestrae, we asked whether caveolin-1 is modified as a possible downstream target of VEGF signal transduction. We incubated ACE cells cultured on the basal lamina-type matrix for various time points with VEGF and performed immunoprecipitations with an antibody against VEGF receptor-2 and the anti–caveolin-1 antibody VIP-21N, which only recognizes the α isoform. VEGF rapidly induced the tyrosine phosphorylation of a 205-kD band, which was identified as the bovine form of the VEGF receptor-2 (Fig. 6,a), confirming the initiation of VEGF-induced signal transduction pathways in ACE cells. However, phosphorylation of caveolin-1 on tyrosine (Fig. 6,b) or serine residues (data not shown) was not observed at any time after VEGF treatment. As a control, treatment of ACE cells with the tyrosine phosphatase inhibitor pervanadate led to tyrosine phosphorylation and association of caveolin-1 with other phosphoproteins with molecular masses of ∼70, 30, 26, and 24-kD (Fig. 6, c and d; Vepa et al., 1997). In contrast to immunofluorescent labeling of caveolin-1 after pervanadate treatment, ACE cells stimulated with VEGF did not differ in caveolin-1 distribution compared to control cells (data not shown). Since we had observed that the number of fused caveolae-like vesicles increased in response to a longer treatment with VEGF, we tested if the amount of caveolin-1 protein was altered in these experiments. However, no change was observed in the expression level of caveolin-1 protein after treatment with VEGF, pervanadate, or PMA (Fig. 7). Taken together, our biochemical and immunofluorescence analyses demonstrate that induction of fenestrae in ACE cells in response to VEGF is not accompanied by a change in caveolin-1 phosphorylation, expression, or distribution.

Discussion

VEGF was first identified as a vascular permeability factor. After cloning murine VEGF and analyzing its distribution by in situ hybridization, we observed a strong correlation of VEGF expression with angiogenesis during embryonic development, e.g., in the brain (Breier et al., 1992). However, we found a continuous expression in epithelial cells of the choroid plexus and kidney glomerulus (podocytes) throughout development into the adult. Since the closely associated endothelial cells of these structures were fenestrated and also constitutively expressed VEGF receptors (Millauer et al., 1993; Breier et al., 1995), we speculated that VEGF might be involved in the induction or maintenance of endothelial fenestrations. This has been recently demonstrated in vivo by Roberts and Palade (1995, 1997) who showed that topical administration of VEGF 165 induced fenestrations in continuous microvascular endothelium of muscle and skin, and that tumor neovasculature induced by VEGF is fenestrated. However, in these in vivo systems, the questions regarding the responsible VEGF isoforms, the roles of contributing factors, supporting cells, and extracellular matrix are difficult to address. Biochemical studies on signal transduction and changes in molecular composition are almost impossible to perform in vivo due to tissue complexity and lack of sufficient material. Therefore, an in vitro system to study the effects of VEGF on fenestrae induction would be valuable.

To develop an in vitro system, we first used CPE in coculture with ACE. Wilting and Christ (1989) have demonstrated that grafting of CPE from quail into the coelomic cavity of chicken embryos induced the differentiation of fenestrated capillaries in vivo. In our in vitro cocultures of ACE cells with CPE, we also observed a strong induction of fenestrae. This prompted us to develop a system in which the direct effects of VEGF could be analyzed. We used a mammary epithelial cell line that by itself secreted very little endogenous VEGF under normal culture conditions. Epithelial cells stably transfected with VEGF cDNAs secreted a high level of VEGF and induced a seven- or eightfold increase in fenestrae and fused clustered vesicles in cocultured endothelial cells, thus providing direct evidence for a role of VEGF in fenestrae induction.

Using a complex basal lamina-type extracellular matrix, we showed that the addition of purified recombinant VEGF, but not bFGF, was sufficient to induce a ten-fold increase in fenestrations in endothelial cells. These progressively better-defined in vitro systems demonstrate for the first time that VEGF is a specific inducer of fenestrations in vitro. The fact that FGF has no major effect on fenestrae induction is interesting, because previous in vivo experiments have noted some effect of FGF (Roberts and Palade, 1997). In agreement with the hypothesis of these authors, we would suggest that FGF acts indirectly by upregulating VEGF or its receptors in the complex in vivo situation, but is unable to directly induce fenestrations in the defined in vitro system.

VEGF 120 and 164 induced fenestrations. Both isoforms are expressed in organs with fenestrated blood vessels (Bacic et al., 1995; Simon et al., 1995; this report) and bind to the high-affinity VEGF receptors-1 and -2 (Gitay-Goren et al., 1996; Keyt et al., 1996) that are expressed in endothelial cells of choroid plexus, kidney glomeruli, and cultured ACE cells (Plouet and Moukadiri, 1990; Vaisman et al., 1990; Millauer et al., 1993; Breier et al., 1995; Simon et al., 1995; this report). So far, different VEGF isoforms have not been observed to exhibit different biological effects (Birkenhager et al., 1996; Wilting et al., 1996; Schmidt and Flamme, 1997), although it was reported that VEGF 165 has an increased affinity for VEGF receptor-1 and a higher mitogenic potency compared to VEGF 121 (Keyt et al., 1996). In any case, our results imply a role for the VEGF isoforms 120 and 164 in fenestrae induction.

In addition to fenestrae formation, a striking induction of fused clustered caveolae-like vesicles with diaphragms was observed after VEGF treatment. Dilated plasmalemmal vesicles that aggregate to form clusters in which the vesicles are fused to one another and are separated by diaphragms provided with central knobs (Roberts and Palade, 1995) have also been referred to as VVOs (Kohn et al., 1992). VVOs have been observed in a small portion of normal venules in vivo (Feng et al., 1996), but seem to occur consistently in tumor vessels (Kohn et al., 1992; Qu et al., 1995). The function of VVOs was shown to be activated after treatment with VEGF in vivo (Feng et al., 1996). VEGF has also been localized to VVOs in tumor-associated microvascular endothelial cells (Qu et al., 1995). Considering the morphological relationship among VVOs, plasmalemmal vesicles, and endothelial fenestrations (e.g., size, presence of diaphragms, and cholesterol dependence) and the ocurrence of endothelial fenestrations as clusters in vivo, we decided to count clustered fenestrae and clustered diaphragmed vesicles together. By analyzing more than 4,500 cellular profiles in transmission electron microscopy, these structures appeared to be interrelated, but the exact temporal and spatial determinants of their formation is presently unclear. However, these observations raise the important question of whether caveolae can fuse and give rise to VVOs, and if subsequent VVOs can give rise to the so-called sieve plates (clusters of fenestrae found in the most attenuated periphery of endothelial cells).

Very little is known about the structural composition and modulation of caveolae, VVOs, and fenestrae. Caveolin-1 is a commonly accepted marker protein for caveolae (Rothberg et al., 1992; Parton et al., 1994; Smart et al., 1994, Stan et al., 1997). We attempted to correlate the distribution and biochemical modification of caveolin-1 with the distribution and induction of caveolae, fenestrae, and VVOs in vivo and in vitro. A considerable fraction of caveolae in endothelial cells of tissues and cocultures could be labeled with anti–caveolin-1 antibodies in immunoelectron microscopy. Clustered diaphragmed vesicles were only very rarely labeled and all fenestrae were negative for caveolin-1, suggesting that caveolin-1 may be specifically excluded from fused clustered vesicles and fenestrae. Therefore, it was interesting to investigate if modification of caveolin-1 after VEGF treatment correlated with the induction of fused clustered vesicles and fenestrae. VEGF did not induce a change in caveolin-1 distribution, tyrosine or serine phosphorylation, or alteration in the protein level of caveolin-1. A change in the distribution of caveolin-1 was observed only after pervanadate stimulation that caused increased tyrosine phosphorylation of caveolin-1 and associated proteins. Our results on tyrosine and serine phosphorylation of caveolin-1 are consistent with previous studies that demonstrated the activation of signaling in caveolae after stimulation with EGF, PDGF, or insulin in the absence of a consistent change in caveolin-1 phosphorylation (Scherer et al., 1994; Mastick et al., 1995; Liu et al., 1996). Although the induction of tyrosine phosphorylation of caveolin-1 after pervanadate treatment has been shown before (Vepa et al., 1997), the nature of the coprecipitated phosphoproteins and their possible relationship to previously identified caveolin-1–associated proteins (Scherer et al., 1994; Mastick et al., 1995; Liu et al., 1996) remains to be established. Whether VEGF receptors are concentrated in caveolae, as has been shown for PDGF receptor (Liu et al., 1996, 1997), EGF receptor (Smart et al., 1995), as well as other tyrosine kinase receptors (Wu et al., 1997), is not yet known, but is strongly suggested by the presence of a consensus binding site (WSF/YGVLLWEIF) for the caveolin-scaffolding domain (Couet et al., 1997a) in their cytoplasmic tails. It is controversial whether caveolin-1 is regulated at the protein level (Glenney, 1989; Koleske et al., 1995; Mineo et al., 1996). Since we did not observe major changes in the amount of caveolin-1 protein after VEGF stimulation, the subcellular localization of caveolin-1 may be altered without concomitant protein degradation or synthesis. Several possibilities such as different caveolin-1 conformations or modifications not recognized by the available antibodies remain to be tested. Alternatively, palmitoylation or the oligomerization properties of caveolin-1 might be altered after VEGF treatment (Monier et al., 1995, 1996). However, the most likely explanation is that fusion of clustered caveolae-like vesicles leading to VVOs and fenestrae is accompanied by a loss of caveolin-1 protein. These observations suggest that although caveolin-1–coated vesicles might be involved in the formation or recruitment of fused diaphragmed vesicles and fenestrae, they do not comprise a structural entity of fenestrae themselves.

Previous in vivo experiments have shown that application of VEGF induced fenestrae in capillaries of skeletal muscle and skin (Roberts and Palade, 1995). Muscle and skin endothelial cells contain the highest number of caveolae and are sometimes found to be fenestrated (Korneliussen, 1975; Wolff, 1977). Therefore, it is possible that VEGF induces fenestrations only in an in vivo or in vitro environment that is permissive for fenestrae formation. One prerequisite for fenestrae formation seems to be a certain threshold number of caveolae. Brain microvessels have the lowest number of caveolae (Coomber and Stewart, 1985), and may be the least inducible endothelial cells. However, endothelial cells in the early embryonic perineural vascular plexus are fenestrated (Yoshida et al., 1988) and the neovasculature of some VEGF-secreting brain tumors has been found to possess endothelial fenestrations (Roberts and Palade, 1997). Fenestrated bovine ACE lose fenestrae when cultured (Folkman and Haudenschild, 1980; Furie et al., 1984), probably due to the withdrawal of VEGF-producing adrenal cortex epithelial cells. These previously fenestrated cells are the most responsive cells in terms of fenestrae inducibility analyzed in vitro so far. We have observed some, though weak, induction of fenestrations in HUVEC cells in vitro. Therefore, VEGF is able to induce fenestrae in previously nonfenestrated endothelial cells, but the magnitude of the response seems to be dependent on the origin of the endothelium. It is conceivable that, in contrast to embryonic endothelium that seems to be more plastic, the responsiveness of adult endothelium is restricted by the counteractive effects of the surrounding microenvironment, e.g., within the brain, to maintain blood–brain barrier and low permeability properties (Risau, 1995).

The other prerequisite for fenestrae formation seems to be an appropriate three-dimensional architecture of the endothelial cell. We demonstrate here that, in our in vitro system, the induction of fenestrae is completely dependent on a basal lamina-type extracellular matrix, because ACE cells cultured on collagen in the presence of VEGF were virtually devoid of fenestrations. These data are supported by our in vivo experiments of retroviral overexpression of VEGF in which we have rarely seen endothelial fenestrae in hypervascularized embryonic tissue (Flamme et al., 1995), and are consistent with the observation that an intact basal lamina forms rather late in vascular development (Risau and Lemmon, 1988). Therefore, both the correct extracellular matrix as well as activation of the relevant receptor seem to be necessary for the formation of fenestrae in endothelial cells. In vivo as well as in vitro, fenestrae are located in extremely attenuated regions of endothelial cells and are often organized as sieve plates. The first morphological effect observed in VEGF-treated endothelial cell cultures was the appearance of branch-like cell sprouts already visible after 6 h of stimulation. These thin cellular extensions also contained an extremely high density of caveolin-1 protein (data not shown). VEGF binding to and activation of its receptors may induce both the flattening of cellular processes and insertion of fenestrations. However, formation of cellular processes was also seen with bFGF (data not shown). Hence, it is unclear if this morphological change is associated with fenestrae induction or rather represents a general effect of VEGF and other growth factors on ACE cells.

Although the morphological characteristics and presence of fenestrae in specific vascular beds has been carefully analyzed, the molecular composition, induction, and maintenance of fenestrations in endothelial cells is still not well understood. Physiological studies have shown that fenestrae provide highly permeable pores for water and small solutes. More recently, based on the high density of cationic ferritin labeling of fenestrae, the anionic glycocalix present in fenestral pores has been investigated in more detail and shown to consist of filamentous plugs (Rostgaard and Qvortrup, 1997). However, this anionic coat may be quite variable, and even absent, in certain capillaries, e.g., in tumors (Roberts and Palade, 1997). These results raise the possibility that the permeability of endothelial fenestrations is not uniform but differs depending on the presence or absence of diaphragms, filamentous plugs, or the composition of the anionic glycocalix. Further insights into the functional heterogeneity of vascular territories in terms of permeability clearly require a molecular definition of fenestrae, diaphragms, caveolae, fused clustered caveolae-like vesicles, and VVOs. The availability of our in vitro system for fenestrae induction allows several important issues to be addressed, e.g., which signal transduction systems in endothelial cells are involved in the formation of cellular processes and fenestrae, and how the signals from VEGF receptor–tyrosine kinases are integrated with the putative integrin signals after their binding to the basal lamina-type extracellular matrix. Furthermore, the activity of VEGF as an endothelial growth versus permeability/fenestrae-inducing factor must be differentially regulated. It is conceivable that the VEGF-secreting epithelial cells induce a similar cascade of signals in the closely associated endothelial cells as required for growth and migration. However, the complex basal lamina and components therein, e.g., inhibitors, may modulate the signal so that no new capillaries form. This is consistent with the notion that epithelia are resistant to vascular invasion. The establishment of our in vitro system of endothelial fenestrations promises to be a useful model to further clarify the molecular mechanisms that are involved in the formation and function of endothelial fenestrations.

References

References
Anderson
RG
Caveolae: where incoming and outgoing messengers meet
Proc Natl Acad Sci USA
1993
90
10909
10913
[PubMed]
Bacic
M
,
Edwards
NA
,
Merrill
MJ
Differential expression of vascular endothelial growth factor (vascular permeability factor) forms in rat tissues
Growth Factors
1995
12
11
15
[PubMed]
Birkenhager
R
,
Schneppe
B
,
Rockl
W
,
Wilting
J
,
Weich
HA
,
McCarthy
JE
Synthesis and physiological activity of heterodimers comprising different splice forms of vascular endothelial growth factor and placenta growth factor
Biochem J
1996
316
703
707
[PubMed]
Breier
G
,
Albrecht
U
,
Sterrer
S
,
Risau
W
Expression of vascular endothelial growth factor during embryonic angiogenesis and endothelial cell differentiation
Development (Camb)
1992
114
521
532
[PubMed]
Breier
G
,
Clauss
M
,
Risau
W
Coordinate expression of vascular endothelial growth factor receptor-1 (flt-1) and its ligand suggests a paracrine regulation of murine vascular development
Dev Dyn
1995
204
228
239
[PubMed]
Brown
LF
,
Berse
B
,
Tognazzi
K
,
Manseau
EJ
,
Van de Water
L
,
Senger
DR
,
Dvorak
HF
,
Rosen
S
Vascular permeability factor mRNA and protein expression in human kidney
Kidney Int
1992
42
1457
1461
[PubMed]
Carley
WW
,
Milici
AJ
,
Madri
JA
Extracellular matrix specificity for the differentiation of capillary endothelial cells
Exp Cell Res
1988
178
426
434
[PubMed]
Chomczynski
P
,
Sacchi
N
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction
Anal Biochem
1987
162
156
159
[PubMed]
Coomber
BL
,
Stewart
PA
Morphometric analysis of CNS microvascular endothelium
Microvasc Res
1985
30
99
115
[PubMed]
Coomber
BL
,
Stewart
PA
,
Hayakawa
K
,
Farrell
CL
,
Del Maestro
RF
Quantitative morphology of human glioblastoma multiforme microvessels: structural basis of blood-brain barrier defect
J Neuro-Oncol
1987
5
299
307
[PubMed]
Coomber
BL
,
Stewart
PA
,
Hayakawa
EM
,
Farrell
CL
,
Del Maestro
RF
A quantitative assessment of microvessel ultrastructure in C6 astrocytoma spheroids transplanted to brain and to muscle
J Neuropathol Exp Neurol
1988
47
29
40
[PubMed]
Couet
J
,
Li
S
,
Okamoto
T
,
Ikezu
T
,
Lisanti
MP
Identification of peptide and protein ligands for the caveolin-scaffolding domain. Implications for the interaction of caveolin with caveolae-associated proteins
J Biol Chem
1997a
272
6525
6533
[PubMed]
Couet
J
,
Li
SW
,
Okamoto
T
,
Scherer
PE
,
Lisanti
MP
Molecular and cellular biology of caveolae—paradoxes and plasticities
Trends Cardiovasc Med
1997b
7
103
110
Dupree
P
,
Parton
RG
,
Raposo
G
,
Kurzchalia
TV
,
Simons
K
Caveolae and sorting in the trans-Golgi network of epithelial cells
EMBO (Eur Mol Biol Organ) J
1993
12
1597
1605
[PubMed]
Dvorak
HF
,
Brown
LF
,
Detmar
M
,
Dvorak
AM
Vascular permeability factor/vascular endothelial growth factor, microvascular hyperpermeability, and angiogenesis
Am J Pathol
1995
146
1029
1039
[PubMed]
Dvorak
AM
,
Kohn
S
,
Morgan
ES
,
Fox
P
,
Nagy
JA
,
Dvorak
HF
The vesiculo-vacuolar organelle (VVO): a distinct endothelial cell structure that provides a transcellular pathway for macromolecular extravasation
J Leukocyte Biol
1996
59
100
115
[PubMed]
Feng
D
,
Nagy
JA
,
Hipp
J
,
Dvorak
HF
,
Dvorak
AM
Vesiculo-vacuolar organelles and the regulation of venule permeability to macromolecules by vascular permeability factor, histamine, and serotonin
J Exp Med
1996
183
1981
1986
[PubMed]
Flamme
I
,
von Reutern
M
,
Drexler
HC
,
Syed-Ali
S
,
Risau
W
Overexpression of vascular endothelial growth factor in the avian embryo induces hypervascularization and increased vascular permeability without alterations of embryonic pattern formation
Dev Biol
1995
171
399
414
[PubMed]
Folkman
J
,
Haudenschild
C
Angiogenesis by capillary endothelial cells in culture
Trans Ophthalmol Soc UK
1980
100
346
353
[PubMed]
Furie
MB
,
Cramer
EB
,
Naprstek
BL
,
Silverstein
SC
Cultured endothelial cell monolayers that restrict the transendothelial passage of macromolecules and electrical current
J Cell Biol
1984
98
1033
1041
[PubMed]
Garcia-Cardena
G
,
Oh
P
,
Liu
J
,
Schnitzer
JE
,
Sessa
WC
Targeting of nitric oxide synthase to endothelial cell caveolae via palmitoylation: implications for nitric oxide signaling
Proc Natl Acad Sci USA
1996
93
6448
6453
[PubMed]
Gatmaitan
Z
,
Varticovski
L
,
Ling
L
,
Mikkelsen
R
,
Steffan
AM
,
Arias
IM
Studies on fenestral contraction in rat liver endothelial cells in culture
Am J Pathol
1996
148
2027
2041
[PubMed]
Ge
AZ
,
Butcher
EC
Cloning and expression of a cDNA encoding mouse endoglin, an endothelial cell TGF-β ligand
Gene
1994
138
201
206
[PubMed]
Ghitescu
L
,
Fixman
A
,
Simionescu
M
,
Simionescu
N
Specific binding sites for albumin restricted to plasmalemmal vesicles of continuous capillary endothelium: receptor-mediated transcytosis
J Cell Biol
1986
102
1304
1311
[PubMed]
Gitay-Goren
H
,
Cohen
T
,
Tessler
S
,
Soker
S
,
Gengrinovitch
S
,
Rockwell
P
,
Klagsbrun
M
,
Levi
B
,
Neufeld
G
Selective binding of VEGF121 to one of the three vascular endothelial growth factor receptors of vascular endothelial cells
J Biol Chem
1996
271
5519
5523
[PubMed]
Glenney
JR
Jr
Tyrosine phosphorylation of a 22-kDa protein is correlated with transformation by Rous sarcoma virus
J Biol Chem
1989
264
20163
20166
[PubMed]
Gospodarowicz, D. 1984. Preparation of Extracellular Matrices Produced by Cultured Bovine Corneal Endothelial Cells: Their Use in Cell Culture. In Methods for preparation of media, supplements and substrata for serum-free animal cell culture. Alan R. Liss, Inc., New York. 275–293.
Jaffe
EA
,
Nachman
RL
,
Becker
CG
,
Minick
CR
Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria
J Clin Invest
1973
52
2745
2756
[PubMed]
Jain
RK
Determinants of tumor blood flow: a review
Cancer Res
1988
48
2641
2658
[PubMed]
Jakeman
LB
,
Winer
J
,
Bennett
GL
,
Altar
CA
,
Ferrara
N
Binding sites for vascular endothelial growth factor are localized on endothelial cells in adult rat tissues
J Clin Invest
1992
89
244
253
[PubMed]
Jarrell
B
,
Levine
E
,
Shapiro
S
,
Williams
S
,
Carabasi
RA
,
Mueller
S
,
Thornton
S
Human adult endothelial cell growth in culture
J Vasc Surg
1984
1
757
764
[PubMed]
Keck
PJ
,
Hauser
SD
,
Krivi
G
,
Sanzo
K
,
Warren
T
,
Feder
J
,
Connolly
DT
Vascular permeability factor, an endothelial cell mitogen related to PDGF
Science
1989
246
1309
1312
[PubMed]
Keyt
BA
,
Berleau
LT
,
Nguyen
HV
,
Chen
H
,
Heinsohn
H
,
Vandlen
R
,
Ferrara
N
The carboxyl-terminal domain (111–165) of vascular endothelial growth factor is critical for its mitogenic potency
J Biol Chem
1996
271
7788
7795
[PubMed]
Kohn
S
,
Nagy
JA
,
Dvorak
HF
,
Dvorak
AM
Pathways of macromolecular tracer transport across venules and small veins. Structural basis for the hyperpermeability of tumor blood vessels
Lab Invest
1992
67
596
607
[PubMed]
Koleske
AJ
,
Baltimore
D
,
Lisanti
MP
Reduction of caveolin and caveolae in oncogenically transformed cells
Proc Natl Acad Sci USA
1995
92
1381
1385
[PubMed]
Korneliussen
H
Fenestrated blood capillaries and lymphatic capillaries in rat skeletal muscle
Cell Tissue Res
1975
163
169
174
[PubMed]
Kurtz
A
,
Jelkmann
W
,
Bauer
C
Mesangial cells derived from rat glomeruli produce an erythropoiesis stimulating factor in cell culture
FEBS (Fed Eur Biochem Soc) Lett
1982
137
129
132
[PubMed]
Kurzchalia
TV
,
Parton
RG
And still they are moving. . . . dynamic properties of caveolae
FEBS (Fed Eur Biochem Soc) Lett
1996
389
52
54
[PubMed]
Kurzchalia
TV
,
Dupree
P
,
Parton
RG
,
Kellner
R
,
Virta
H
,
Lehnert
M
,
Simons
K
VIP21, a 21-kD membrane protein is an integral component of trans-Golgi network–derived transport vesicles
J Cell Biol
1992
118
1003
1014
[PubMed]
Laemmli
UK
Cleavage of structural proteins during the assembly of the head of bacteriophage T4
Nature
1970
227
680
685
[PubMed]
Lampugnani
MG
,
Resnati
M
,
Raiteri
M
,
Pigott
R
,
Pisacane
A
,
Houen
G
,
Ruco
LP
,
Dejana
E
A novel endothelial-specific membrane protein is a marker of cell–cell contacts
J Cell Biol
1992
118
1511
1522
[PubMed]
Levick
JR
,
Smaje
LH
An analysis of the permeability of a fenestra
Microvasc Res
1987
33
233
256
[PubMed]
Lisanti
MP
,
Scherer
PE
,
Vidugiriene
J
,
Tang
Z
,
Hermanowski-Vosatka
A
,
Tu
YH
,
Cook
RF
,
Sargiacomo
M
Characterization of caveolin-rich membrane domains isolated from an endothelial-rich source: implications for human disease
J Cell Biol
1994
126
111
126
[PubMed]
Liu
P
,
Ying
Y
,
Ko
YG
,
Anderson
RG
Localization of platelet-derived growth factor-stimulated phosphorylation cascade to caveolae
J Biol Chem
1996
271
10299
10303
[PubMed]
Liu
J
,
Oh
P
,
Horner
T
,
Rogers
RA
,
Schnitzer
JE
Organized endothelial cell surface signal transduction in caveolae distinct from glycosylphosphatidylinositol-anchored protein microdomains
J Biol Chem
1997
272
7211
7222
[PubMed]
Lombardi
T
,
Montesano
R
,
Furie
MB
,
Silverstein
SC
,
Orci
L
Endothelial diaphragmed fenestrae: in vitro modulation by phorbol myristate acetate
J Cell Biol
1986
102
1965
1970
[PubMed]
Lombardi
T
,
Montesano
R
,
Furie
MB
,
Silverstein
SC
,
Orci
L
In vitro modulation of endothelial fenestrae: opposing effects of retinoic acid and transforming growth factor β
J Cell Sci
1988
91
313
318
[PubMed]
Mastick
CC
,
Brady
MJ
,
Saltiel
AR
Insulin stimulates the tyrosine phosphorylation of caveolin
J Cell Biol
1995
129
1523
1531
[PubMed]
McGuire
RF
,
Bissell
DM
,
Boyles
J
,
Roll
FJ
Role of extracellular matrix in regulating fenestrations of sinusoidal endothelial cells isolated from normal rat liver
Hepatology
1992
15
989
997
[PubMed]
Milici
AJ
,
Furie
MB
,
Carley
WW
The formation of fenestrations and channels by capillary endothelium in vitro
Proc Natl Acad Sci USA
1985
82
6181
6185
[PubMed]
Millauer
B
,
Wizigmann-Voos
S
,
Schnürch
H
,
Martinez
R
,
Moller
NP
,
Risau
W
,
Ullrich
A
High affinity VEGF binding and developmental expression suggest Flk-1 as a major regulator of vasculogenesis and angiogenesis
Cell
1993
72
835
846
[PubMed]
Mineo
C
,
James
GL
,
Smart
EJ
,
Anderson
RG
Localization of epidermal growth factor-stimulated Ras/Raf-1 interaction to caveolae membrane
J Biol Chem
1996
271
11930
11935
[PubMed]
Monacci
WT
,
Merrill
MJ
,
Oldfield
EH
Expression of vascular permeability factor/vascular endothelial growth factor in normal rat tissues
Am J Physiol
1993
264
C995
1002
[PubMed]
Monier
S
,
Parton
RG
,
Vogel
F
,
Behlke
J
,
Henske
A
,
Kurzchalia
TV
VIP21-caveolin, a membrane protein constituent of the caveolar coat, oligomerizes in vivo and in vitro
Mol Biol Cell
1995
6
911
927
[PubMed]
Monier
S
,
Dietzen
DJ
,
Hastings
WR
,
Lublin
DM
,
Kurzchalia
TV
Oligomerization of VIP21-caveolin in vitro is stabilized by long chain fatty acylation or cholesterol
FEBS (Fed Eur Biochem Soc) Lett
1996
388
143
149
[PubMed]
Mulder
AB
,
Smit
JW
,
Bom
VJ
,
Blom
NR
,
Ruiters
MH
,
Halie
MR
,
van der Meer
J
Association of smooth muscle cell tissue factor with caveolae
Blood
1996
88
1306
1313
[PubMed]
Murata
M
,
Peranen
J
,
Schreiner
R
,
Wieland
F
,
Kurzchalia
TV
,
Simons
K
VIP21/caveolin is a cholesterol-binding protein
Proc Natl Acad Sci USA
1995
92
10339
10343
[PubMed]
Oft
M
,
Peli
J
,
Rudaz
C
,
Schwarz
H
,
Beug
H
,
Reichmann
E
TGF-β1 and Ha-Ras collaborate in modulating the phenotypic plasticity and invasiveness of epithelial tumor cells
Genes Dev
1996
10
2462
2477
[PubMed]
Palade
GE
,
Simionescu
M
,
Simionescu
N
Structural aspects of the permeability of the microvascular endothelium
Acta Physiol Scand Suppl
1979
463
11
32
[PubMed]
Parton
RG
Caveolae and caveolins
Curr Opin Cell Biol
1996
8
542
548
[PubMed]
Parton
RG
,
Joggerst
B
,
Simons
K
Regulated internalization of caveolae
J Cell Biol
1994
127
1199
1215
[PubMed]
Plouet
J
,
Moukadiri
H
Characterization of the receptor to vasculotropin on bovine adrenal cortex-derived capillary endothelial cells
J Biol Chem
1990
265
22071
22074
[PubMed]
Poltorak
Z
,
Cohen
T
,
Sivan
R
,
Kandelis
Y
,
Spira
G
,
Vlodavsky
I
,
Keshet
E
,
Neufeld
G
VEGF145, a secreted vascular endothelial growth factor isoform that binds to extracellular matrix
J Biol Chem
1997
272
7151
7158
[PubMed]
Predescu
D
,
Horvat
D
,
Predescu
S
,
Palade
GE
Transcytosis in the continuous endothelium of the myocardial microvasculature is inhibited by N-ethylmaleimide
Proc Natl Acad Sci USA
1994
91
3014
3018
[PubMed]
Qu
H
,
Nagy
JA
,
Senger
DR
,
Dvorak
HF
,
Dvorak
AM
Ultrastructural localization of vascular permeability factor/vascular endothelial growth factor (VPF/VEGF) to the abluminal plasma membrane and vesiculovacuolar organelles of tumor microvascular endothelium
J Histochem Cytochem
1995
43
381
389
[PubMed]
Rhodin, J.A.G. 1974. Histology. A Text and Atlas. Oxford University Press, New York. 803 pp.
Risau
W
Differentiation of endothelium
FASEB (Fed Am Soc Exp Biol) J
1995
9
926
933
[PubMed]
Risau
W
,
Lemmon
V
Changes in the vascular extracellular matrix during embryonic vasculogenesis and angiogenesis
Dev Biol
1988
125
441
450
[PubMed]
Roberts
WG
,
Palade
GE
Increased microvascular permeability and endothelial fenestration induced by vascular endothelial growth factor
J Cell Sci
1995
108
2369
2379
[PubMed]
Roberts
WG
,
Palade
GE
Neovasculature induced by vascular endothelial growth factor is fenestrated
Cancer Res
1997
57
765
772
[PubMed]
Rostgaard
J
,
Qvortrup
K
Electron microscopic demonstrations of filamentous molecular sieve plugs in capillary fenestrae
Microvasc Res
1997
53
1
13
[PubMed]
Rothberg
KG
,
Heuser
JE
,
Donzell
WC
,
Ying
YS
,
Glenney
JR
,
Anderson
RG
Caveolin, a protein component of caveolae membrane coats
Cell
1992
68
673
682
[PubMed]
Sargiacomo
M
,
Sudol
M
,
Tang
Z
,
Lisanti
MP
Signal transducing molecules and glycosyl-phosphatidylinositol–linked proteins form a caveolin-rich insoluble complex in MDCK cells
J Cell Biol
1993
122
789
807
[PubMed]
Scherer
PE
,
Lisanti
MP
,
Baldini
G
,
Sargiacomo
M
,
Mastick
CC
,
Lodish
HF
Induction of caveolin during adipogenesis and association of GLUT4 with caveolin-rich vesicles
J Cell Biol
1994
127
1233
1243
[PubMed]
Scherer
PE
,
Tang
Z
,
Chun
M
,
Sargiacomo
M
,
Lodish
HF
,
Lisanti
MP
Caveolin isoforms differ in their N-terminal protein sequence and subcellular distribution. Identification and epitope mapping of an isoform-specific monoclonal antibody probe
J Biol Chem
1995
270
16395
16401
[PubMed]
Scherer
PE
,
Okamoto
T
,
Chun
M
,
Nishimoto
I
,
Lodish
HF
,
Lisanti
MP
Identification, sequence, and expression of caveolin-2 defines a caveolin gene family
Proc Natl Acad Sci USA
1996
93
131
135
[PubMed]
Schmidt, M., and I. Flamme. 1997. The in vivo activity of vascular endothelial growth factor isoforms in the avian embryo. Growth Factors. In press.
Schnitzer
JE
,
Oh
P
,
Pinney
E
,
Allard
J
Filipin-sensitive caveolae-mediated transport in endothelium: reduced transcytosis, scavenger endocytosis, and capillary permeability of select macromolecules
J Cell Biol
1994
127
1217
1232
[PubMed]
Senger
DR
,
Galli
SJ
,
Dvorak
AM
,
Perruzzi
CA
,
Harvey
VS
,
Dvorak
HF
Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid
Science
1983
219
983
985
[PubMed]
Shaul
PW
,
Smart
EJ
,
Robinson
L
,
German
Z
,
Yuhanna
IS
,
Ying
Y
,
Anderson
RG
,
Michel
T
Acylation targets emdotheil nitric-oxide synthase to plasmalemmal caveolae
J Biol Chem
1996
271
6518
6522
[PubMed]
Shibata
S
Ultrastructure of capillary walls in human brain tumors
Acta Neuropathol
1989
78
561
571
[PubMed]
Simon
M
,
Grone
HJ
,
Johren
O
,
Kullmer
J
,
Plate
KH
,
Risau
W
,
Fuchs
E
Expression of vascular endothelial growth factor and its receptors in human renal ontogenesis and in adult kidney
Am J Physiol
1995
268
F240
250
[PubMed]
Smart
EJ
,
Ying
YS
,
Conrad
PA
,
Anderson
RG
Caveolin moves from caveolae to the Golgi apparatus in response to cholesterol oxidation
J Cell Biol
1994
127
1185
1197
[PubMed]
Smart
EJ
,
Ying
YS
,
Mineo
C
,
Anderson
RG
A detergent-free method for purifying caveolae membrane from tissue culture cells
Proc Natl Acad Sci USA
1995
92
10104
10108
[PubMed]
Smart
EJ
,
Ying
Y
,
Donzell
WC
,
Anderson
RG
A role for caveolin in transport of cholesterol from endoplasmic reticulum to plasma membrane
J Biol Chem
1996
271
29427
29435
[PubMed]
Song
KS
,
Scherer
PE
,
Tang
Z
,
Okamoto
T
,
Li
S
,
Chafel
M
,
Chu
C
,
Kohtz
DS
,
Lisanti
MP
Expression of caveolin-3 in skeletal, cardiac, and smooth muscle cells. Caveolin-3 is a component of the sarcolemma and co-fractionates with dystrophin and dystrophin-associated glycoproteins
J Biol Chem
1996
271
15160
15165
[PubMed]
Stadler, E., T. Thomas, and M. Dziadek. 1994. In vitro culture of mouse fetal choroid plexus epithelial cells. In Cell Biology. A Laboratory Handbook. J.E. Celis, editor. Academic Press, Inc., NY. 109–115.
Stan
R
,
Roberts
WG
,
Predescu
D
,
Ihida
K
,
Saucan
L
,
Ghitescu
L
,
Palade
GE
Immunoisolation and partial characterization of endothelial plasmalemmal vesicles (caveolae)
Mol Biol Cell
1997
8
595
605
[PubMed]
Steffan
AM
,
Gendrault
JL
,
Kirn
A
Increase in the number of fenestrae in mouse endothelial liver cells by altering the cytoskeleton with cytochalasin B
Hepatology
1987
7
1230
1238
[PubMed]
Tang
Z
,
Scherer
PE
,
Okamoto
T
,
Song
K
,
Chu
C
,
Kohtz
DS
,
Nishimoto
I
,
Lodish
HF
,
Lisanti
MP
Molecular cloning of caveolin-3, a novel member of the caveolin gene family expressed predominantly in muscle
J Biol Chem
1996
271
2255
2261
[PubMed]
Tischer
E
,
Mitchell
R
,
Hartman
T
,
Silva
M
,
Gospodarowicz
D
,
Fiddes
JC
,
Abraham
JA
The human gene for vascular endothelial growth factor. Multiple protein forms are encoded through alternative exon splicing
J Biol Chem
1991
266
11947
11954
[PubMed]
Vaisman
N
,
Gospodarowicz
D
,
Neufeld
G
Characterization of the receptors for vascular endothelial growth factor
J Biol Chem
1990
265
19461
19466
[PubMed]
Vecchi
A
,
Garlanda
C
,
Lampugnani
MG
,
Resnati
M
,
Matteucci
C
,
Stoppacciaro
A
,
Schnuerch
H
,
Risau
W
,
Ruco
L
,
Mantovani
A
,
Dejana
E
Monoclonal antibodies specific for endothelial cells of mouse blood vessels. Their application in the identification of adult and embryonic endothelium
Eur J Cell Biol
1994
63
247
254
[PubMed]
Vepa
S
,
Scribner
WM
,
Natarajan
V
Activation of protein phosphorylation by oxidants in vascular endothelial cells: identification of tyrosine phosphorylation of caveolin
Free Radical Biol Med
1997
22
25
35
[PubMed]
Waltenberger
J
,
Claesson-Welsh
L
,
Siegbahn
A
,
Shibuya
M
,
Heldin
CH
Different signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor
J Biol Chem
1994
269
26988
26995
[PubMed]
Way
M
,
Parton
RG
M-caveolin, a muscle-specific caveolin-related protein
FEBS (Fed Eur Biochem Soc) Lett
1995
376
108
112
[PubMed]
Wilting
J
,
Christ
B
An experimental and ultrastructural study on the development of the avian choroid plexus
Cell Tissue Res
1989
255
487
494
[PubMed]
Wilting
J
,
Birkenhager
R
,
Eichmann
A
,
Kurz
H
,
Martiny-Baron
G
,
Marme
D
,
McCarthy
JE
,
Christ
B
,
Weich
HA
VEGF121 induces proliferation of vascular endothelial cells and expression of flk-1 without affecting lymphatic vessels of chorioallantoic membrane
Dev Biol
1996
176
76
85
[PubMed]
Wizigmann-Voos
S
,
Breier
G
,
Risau
W
,
Plate
KH
Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas
Cancer Res
1995
55
1358
1364
[PubMed]
Wolff, J.R. 1977. Ultrastructure of the Terminal Vascular Bed as Related to Function. In Microcirculation. G. Kaley and B.M. Altura, editors. University Park Press, Baltimore, MD, and London, UK. 95–130.
Wu
C
,
Butz
S
,
Ying
Y
,
Anderson
RG
Tyrosine kinase receptors concentrated in caveolae-like domains from neuronal plasma membrane
J Biol Chem
1997
272
3554
3559
[PubMed]
Yoshida
Y
,
Yamada
M
,
Wakabayashi
K
,
Ikuta
F
Endothelial fenestrae in the rat fetal cerebrum
Dev Brain Res
1988
44
211
219

We thank B. Engelhardt, H. Drexler, S. Bamforth (all from Max Planck Institut für physiologische und klinische Forschung), U. Kniesel, and H. Gerhardt (Universität Tübingen) for their helpful comments on the manuscript.

This work was supported by the Max Planck Society and SUGEN, Inc.

Address all correspondence to Werner Risau, Max Planck Institut für Physiologische und Klinische Forschung, W.G. Kerckhoff Institut, Abteilung Molekulare Zellbiologie, Parkstr. 1, 61231 Bad Nauheim, Germany. Tel.: (49) 603-272-073. Fax: (49) 603-272-259. E-mail: wrisau@kerckhoff.mpg.de

1. Abbreviations used in this paper: ACE, adrenal cortex endothelial cells; CPE, choroid plexus epithelial cells; HMSS, Hanks modified salt solution; HUVEC, human umbilical vein endothelial cells; PMA, phorbol myristate acetate; RT, reverse transcription; VEGF, vascular endothelial growth factor; VVO, vesiculo-vacuolar organelle.