After interaction of human immunodeficiency virus type 1 (HIV-1) virions with cell surface receptors, a series of poorly characterized events results in establishment of a viral reverse transcription complex in the host cell cytoplasm. This process is coordinated in such a way that reverse transcription is initiated shortly after formation of the viral reverse transcription complex. However, the mechanism through which virus entry and initiation of reverse transcription are coordinated and how these events are compartmentalized in the infected cell are not known. In this study, we demonstrate that viral reverse transcription complexes associate rapidly with the host cell cytoskeleton during HIV-1 infection and that reverse transcription occurs almost entirely in the cytoskeletal compartment. Interruption of actin polymerization before virus infection reduced association of viral reverse transcription complexes with the cytoskeleton. In addition, efficient reverse transcription was dependent on intact actin microfilaments. The localization of reverse transcription to actin microfilaments was mediated by the interaction of a reverse transcription complex component (gag MA) with actin but not vimentin (intermediate filaments) or tubulin (microtubules). In addition, fusion, but not endocytosis-mediated HIV-1 infectivity, was impaired when actin depolymerizing agents were added to target cells before infection but not when added after infection. These results point to a previously unsuspected role for the host cell cytoskeleton in HIV-1 entry and suggest that components of the cytoskeleton promote establishment of the reverse transcription complex in the host cell and also the process of reverse transcription within this complex.

Efficient infection of a cell by the primate lentivirus HIV-1 involves receptor engagement by the virus and fusion between viral and host cell membranes (for a review, see reference 1). After this initial interaction, a poorly defined uncoating step leads to release of viral nucleic acids from the capsid (gag CA)1 core. The uncoating process ultimately results in the formation of a reverse transcription complex that comprises the structural gag matrix (MA) protein (27) and the enzymatic proteins, reverse transcriptase and integrase (2, 3, 8), which are derived from the virion and in which viral cDNA synthesis proceeds (for a review, see reference 9). The structural gag MA protein is tightly associated with the reverse transcription complex, and conditions that promote dissociation of integrase do not affect association of gag MA (7). In addition, gag MA within reverse transcription complexes is myristoylated (10), and this modification is important in promoting membrane targeting of gag MA (within the context of gag polyprotein) to the plasma membrane (1113). During virus entry, the membrane targeting property of myristoylated gag MA is regulated by phosphorylation (6, 10, 14). Nonphosphorylated gag MA is predominantly localized to the cell membrane. Phosphorylated gag MA, which is in viral reverse transcription complexes, is not membrane-associated (10). This likely allows free translocation of the reverse transcription complex from the point of virus entry to the host cell nucleus (6, 10, 14). Gag MA has also been implicated in promoting the nuclear translocation of viral reverse transcription complexes. Mutations within a basic domain of gag MA that bears similarities to a canonical nuclear localization signal (2, 3) influence nuclear targeting of the reverse transcription complex in nondividing cells (2, 3, 5, 6, 15). However, mutations within the basic domain are not sufficient to prevent the nuclear translocation step (16, 17), suggesting that additional virion proteins promote translocation of the reverse transcription complex to the nucleus. In support of this, several groups have demonstrated that a virion-packaged accessory gene product, Vpr, also associates with the viral reverse transcription complex (5) and facilitates its nuclear translocation (5, 1822). A cooperative model of MA/Vpr nuclear import has been suggested by the demonstration that gag MA binds to karyopherin in a Vpr-dependent manner (23). In addition, integrase has been shown to promote nuclear targeting of the reverse transcription complex in a cooperative manner with MA and Vpr proteins (18). While the actual roles played by gag MA in virus entry are still being defined, the protein represents a marker with which to monitor the fate of the viral reverse transcription complex during HIV-1 infection.

Several features of virus entry distinguish animal oncoretroviruses from primate lentiviruses. The virion core of oncoretroviruses and lentiviruses are comprised of gag CA protein. Although the reverse transcription complexes of oncoretroviruses such as murine leukemia virus (MLV) contain gag CA (24), those of HIV-1 contain gag MA (24, 6, 7). The process that effects this rearrangement of virion proteins during HIV-1 entry is not known. Similarly, there is little information on how the process of reverse transcription is initiated after formation of the reverse transcription complex within the target cell. Reverse transcription can be initiated within HIV-1 virions; however, the process is very inefficient and results predominantly in synthesis of early reverse transcripts (2527). Although the processes of HIV-1 reverse transcription and nuclear translocation proceed concurrently, reverse transcription in vivo proceeds at ∼1 nucleotide/s (28), whereas reverse transcription complexes translocate to the host cell nucleus as early as 1 h after infection (10, 29). Thus, after HIV-1 infection it is likely that the majority of reverse transcription complexes in the nucleus contain incomplete viral transcripts that are still undergoing reverse transcription. After MLV infection, where nuclear import is dependent on mitosis, the majority of reverse transcription is completed before nuclear import (3032).

To better understand early events in the life cycle of HIV-1, we analyzed compartmentalization of viral reverse transcription complexes in the host cell early after virus infection. We demonstrate that viral reverse transcription complexes rapidly associate with actin microfilaments of the host cell cytoskeleton after infection. This association was necessary for efficient entry of viral nucleic acids into the target cell and for the efficient reverse transcription of genomic viral RNA. These observations suggest a model in which the cytoskeleton provides a cofactor or acts as a scaffold for the appropriate localization and activation of the viral reverse transcription complex and, ultimately, for efficient infection of the cell by HIV-1.

Materials And Methods

Generation of Viral Stocks.

293T cells (33) were maintained in DME supplemented with penicillin (100 U/ml), streptomycin (100 μg/ml), and 10% fetal bovine serum (FBS). For generation of viral stocks, 293T cells were transfected with HIV-1LAI (34) proviral DNA (25 μg) using a modified calcium phosphate/DNA precipitation method (GIBCO BRL, Gaithersburg, MD) and incubated at 37°C. Virions in culture supernatants were collected at 24 and 48 h after transfection and either used directly for infection or amplified in MT-4 T cells in RPMI 1640 supplemented with 2 mM l-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, and 10% FBS. Pseudotype viruses were obtained after cotransfection of 293T cells with a vesicular stomatitis virus (VSV)-G envelope expression vector and an HIV-1LAI clone containing a 600-bp deletion in gp120 coding sequences as described previously (35, 36). Calcium phosphate–transfected culture supernatants were collected at 48 h after transfection. Virus particles in culture supernatants were quantitated by measurement of reverse transcriptase activity. For preparation of 32P-gag MA– labeled virions, productively infected CD4+ MT-4 cells were incubated in the presence of 0.5 mCi ortho [32P]phosphate per ml in phosphate-free medium containing 0.1% calf serum. After a 6-h incubation, culture supernatants were cleared of cellular debris by low-speed centrifugation (1,500 g, 10 min), and virions in clarified supernatants were harvested after high-speed centrifugation (10,000 g, 2 h).

Subcellular Fractionation.

Subcellular fractions of HIV-1– infected MT-4 cells and HeLa-CD4-LTR/β-gal “Magi” cells comprising cell membrane, cytosolic, cytoskeletal, and nuclear extracts were prepared essentially as described elsewhere (20). Cells were pelleted and washed in a hypotonic solution (10 mM Hepes, pH 6.9, 10 mM KCl, 3 μl/ml aprotinin, 0.1 mM PMSF) and incubated on ice in hypotonic solution for 15–20 min. Cells were disrupted by dounce homogenization (20 strokes). Nuclei were pelleted at 1,000 g (3 min), supernatant was removed, and nuclei were further purified by three successive washes (retained as nuclear wash extract) in NTENT buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1 mM EDTA, 3 μl/ml aprotinin, 0.1 mM PMSF, 1% Triton X-100). Supernatant from pelleted nuclei was further centrifuged at 14,000 g for 30 min. The supernatant (cytosolic fraction) was separated, and the pellet was further resuspended in NTENT and recentrifuged at 14,000 g for 30 min. The resulting pellet comprises the cytoskeletal fraction, while the supernatant comprises the membrane fraction.

Western Blot Analysis.

Subcellular fractions from an equivalent of 106 cells were adjusted to 62.5 mM Tris-HCl, pH 6.8, 0.2% SDS, 5% 2-ME, 10% glycerol. Samples were denatured by boiling and separated on 12% SDS-polyacrylamide gels. After electrophoresis, proteins were transferred to nitrocellulose (Hybond C Extra; Amersham Pharmacia Biotech, Inc., Piscataway, NY), blocked in 5% milk, and incubated with the respective antibody. Bound antibodies were visualized with peroxidase anti-Ig followed by enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech, Inc.). All Western blot images were within the linear range of the ECL assay. Rhodamine-conjugated phalloidin and antibodies to tubulin, vimentin, actin, and myosin were obtained from Sigma Chemical Co. (St. Louis, MO). For those experiments comparing protein distribution between different cellular compartments, cell lysate from an equivalent of 106 cells was resolved in each lane. This allowed for qualitative comparison of protein distribution between cellular compartments. For those experiments comparing the effect of cytoskeletal inhibitors on protein distribution within the same cellular compartment, the amount of total protein in each lane was adjusted to equivalent levels and, as a consequence, more quantitative comparisons could be made.

Analysis of In Vivo Interaction between Cytoskeletal and Virion Proteins.

MT-4 cells were harvested 1.5 h after infection. Lysates of infected and uninfected cells were obtained by disruption of cells in immunoprecipitation buffer (50 mM Hepes, pH 6.9, 10 mM EDTA, 1% Triton X-100, 3 μl/ml aprotinin, 1 mM PMSF). The extracts were centrifuged at 1,000 g (3 min), and supernatants were precleared with normal rabbit antiserum (6 h, 4°C). Precleared lysates were adjusted to 100, 300, and 800 mM NaCl. Viral proteins were immunoprecipitated with rabbit anti-CA and anti-MA antibodies overnight at 4°C in the presence of protein A and G. Bound immunoprecipitates were washed five times in immunoprecipitation buffer and resolved on 15% SDS-PAGE gels. Proteins were transferred to Highbond C Extra (Amersham Pharmacia Biotech, Inc.) and analyzed by Western blotting with antibodies to tubulin, vimentin, actin, and myosin (Sigma Chemical Co.). Bound antibodies were visualized with peroxidase anti-Ig, followed by ECL (Amersham Pharmacia Biotech, Inc.).

Immunohistochemistry.

Cells were seeded onto 12-well plates containing 0.13-mm-thick coverslips. Cells were grown for 24 h at 37°C in DME containing 10% FBS, Hygromycin (100 μg/ml), and G418 (200 μg/ml). For cytoskeletal staining, coverslips containing adherent cells were removed and rinsed two to three times with warm (37°C) PBS. Coverslips were placed in a petri dish and permeabilized with a solution of 0.1% Triton X-100 in PBS for 1 min, then washed twice with warm PBS. Cells were then immediately placed in warm (37°C), freshly prepared formaldehyde-Triton solution (4% formaldehyde, 0.2% Triton X-100, 60 mM Pipes, 25 mM Hepes, 10 mM EGTA, 3 mM MgCl2, pH 6.1) for 10 min. The coverslips were then rinsed two to three times with room temperature PBS. To reduce nonspecific background staining, fixed cells were incubated with PBS containing 1% BSA for 15 min and washed twice with PBS before addition of staining solutions. For staining of actin microfilaments, cells were overlaid with 200 μl of a PBS/1% BSA solution containing 5 U/ml Texas Red phalloidin (Molecular Probes, Inc., Eugene, OR). Cells were incubated at room temperature for 20–30 min and then rinsed twice with PBS. For tubulin and vimentin visualization, permeabilized cells were overlaid with PBS/1% BSA containing tubulin (DM1A) and vimentin (V9) antibodies (Sigma Chemical Co.) for 20 min. Cells were washed twice in PBS and then incubated with FITC-conjugated donkey anti–mouse IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Stained cells were mounted in Vectashield (Vector Laboratories, Inc., Burlingame, CA) to minimize photo-bleaching. Images were generated on a fluorescence microscope (Axioplan II; Carl Zeiss, Jena, Germany) using the appropriate FITC and Texas Red filter sets. Photographs were obtained with a Plan Apochromat objective (63× 1.40) under oil immersion.

PCR Analysis of HIV-1 cDNA Synthesis.

Total cellular DNA was isolated from acutely infected cells using an IsoQuick DNA extraction protocol (Microprobe Corp., Bothell, WA). Minus-strand HIV-1 strong-stop cDNA products were amplified using LTR R (5′-g635 tgctagagattttccacactgac) and U5 (5′-g496 gctaactaggaacccactg) primers as described previously (37). Late reverse transcription products were amplified by LTR R (5′-g485 ggagctctctggctaact) and gag (5′-g931 gattaactgcgaatcgttc) primers. Viral cDNA was amplified in 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, and 0.001% (wt/vol) gelatin. After the initial denaturation (95°C, 2 min), amplification proceeded for 25 or 35 cycles of PCR (95°C, 30 s; 58°C, 30 s; 72°C, 1 min) followed by a final 5-min extension at 72°C. HIV-1 copy number standards were generated by PCR on serial twofold dilutions of 8E5 cells (each cell containing a defective provirus [38]). PCR products were Southern blotted onto nylon membranes and hybridized with a mixture of two 32P-labeled oligonucleotide probes (5′-g566 tctgttgtgactctggt, 5′-g584 taactagagatccctcagac) for detection of both early and late products of reverse transcription. Primers are numbered according to the HIV-1HXB2 sequence (39). Hybridized PCR products were visualized on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). Hybridized products were quantitated by volume integration (local mean background subtraction was applied) using ImageQuant software (Molecular Dynamics).

Single-cycle Infectivity Assays.

HeLa-CD4-LTR/β-gal Magi indicator cells (35) were plated in 96-well microtiter plates (2 × 104 cells/well). HIV-1 virions (normalized to reverse transcription activity) were added in doubling dilutions to triplicate wells. At 48 h after infection, cells were harvested for quantitation of β-galactosidase production after hydrolysis of X-gal in vitro (Promega Corp., Madison, WI).

Results

Viral Reverse Transcription Complexes Rapidly Associate with the Host Cell Cytoskeleton.

Gag MA is tightly associated with the viral transcription complex (2, 3, 7) likely through a high-affinity interaction with genomic viral RNA (40; our unpublished results), and thus represents a marker with which to follow the distribution of the reverse transcription complex in the infected cell. At 1 h after infection, MT-4 cells were fractionated into cytoplasmic, nuclear, cytoskeletal, and membrane fractions. The purity of the fractions was assessed by Western blotting with antibodies to cytoskeletal proteins (actin, tubulin), nuclear proteins (histone H1), and membrane proteins (CD4). Cytoskeletal proteins were detected primarily in cytosolic and cytoskeletal fractions and were absent from the nucleus (Fig. 1,A). Actin is present in the cell in two forms, as polymerized filaments and as unpolymerized monomers. Polymerized actin is enriched in cytoskeletal fractions, whereas much of the actin that is recovered from cytosolic extracts is in the unpolymerized form. The degree of actin polymerization varies between experiments and, as a consequence, the amount of actin recovered in cytosolic fractions varies between experiments. Histone H1 was present in nuclear fractions but not cytosolic or cytoskeletal fractions. CD4, the principal receptor for HIV-1, was restricted to membrane and cytoskeletal fractions, in agreement with previous reports (41, 42). Gag MA was found in all fractions with the exception of the cytoplasm (Fig. 1,B). We and others have previously demonstrated that gag MA that is associated with reverse transcription complexes is phosphorylated whereas that associated with membranes is not (6, 10, 14). Upon infection of cells with HIV-1 virions containing 32P-gag MA, phosphorylated gag MA protein was localized exclusively to the nucleus and to the cytoskeleton (Fig. 1,C). In agreement with our previously published results (10), phosphorylated gag MA was excluded from the membrane despite the fact that the majority of gag MA in the acutely infected cell remains membrane associated (Fig. 1, B and C). Thus, gag MA in the cytoskeletal fraction was associated with viral reverse transcription complexes and did not represent contamination of that fraction with membrane-associated virion proteins. To examine the kinetics with which viral reverse transcription complexes associated with the cytoskeleton and the nucleus, cells were infected and subcellular fractions were prepared at early intervals after infection. Gag MA appeared in the cytoskeleton within 20 min of infection (Fig. 1,D), whereas its appearance in the nucleus was not evident until 60 min after infection (Fig. 1 D).

We next determined whether the association of the reverse transcription complex with the cytoskeleton was sensitive to cytoskeleton-disrupting agents. MT-4 cells were treated for 2 h with cytochalasin D (CCD, 5 μM), a specific inhibitor of actin polymerization (43, 44). Cells were then infected with HIV-1 and infection was allowed to proceed in the absence of CCD. At 1 h after infection, there was a reduction in the amount of gag MA present in the cytoskeletal and nuclear fractions, whereas there was a slight increase in the amount of gag MA associated with the membrane (Fig. 2,A). Since infection proceeded in the absence of CCD and the effects of CCD are reversible, there was a slight restoration of gag MA association with the cytoskeleton and nucleus when the distribution was examined at 5 h after infection (Fig. 2,A). In comparison, treatment of cells with demecolcine, which causes perinuclear aggregation of intermediate filaments (45), or with nocodazole, a specific inhibitor of tubulin polymerization into microtubules (46), did not significantly affect the association of gag MA with the cytoskeleton (Fig. 2,B). The inhibitory effects of CCD were dependent on the time of drug addition. When cells were treated with CCD for either 1 or 2 h before virus infection, the amount of gag MA in the cytoskeleton and in the nucleus was markedly reduced (Fig. 2,C). The presence of gag MA in the cytoskeleton or nucleus was not significantly affected if CCD was added as early as 1 h after infection (Fig. 2,C). Treatment of cells with CCD inhibits actin polymerization; however, monomeric actin could still be recovered from the cytoskeletal fraction of CCD-treated cells (Fig. 2 D). In addition, inhibition of actin polymerization resulted in an increase in the amount of actin recovered from the cytosolic fraction, likely as a consequence of increased levels of monomeric actin. The presence of gag MA in the cytoskeletal and nuclear fractions of cells treated with CCD after virus infection suggests that the interaction between the reverse transcription complex and the cytoskeleton is retained whether actin is monomeric or polymerized. Since gag MA rapidly associates with the cytoskeleton, and CCD did not affect this association when added 1 h after infection, the results suggest that, once established, the interaction between the reverse transcription complex and the cytoskeleton is not reversed upon actin depolymerization.

Interaction between Gag MA and Actin In Vivo.

We next investigated the mechanism by which viral reverse transcription complexes associated with the cytoskeleton. Recent studies have suggested an interaction between HIV-1 gag polyprotein and F-actin present in microfilaments (47). Therefore, we determined whether the two major processed products of gag polyprotein in the virion, namely gag MA and gag CA, associated with actin in vivo. Cell extracts were prepared from uninfected MT-4 cells and from MT-4 cells 1 h after HIV-1 infection. Lysates of infected and uninfected cells were adjusted to 100, 300, and 800 mM NaCl and immunoprecipitated with antibodies to gag MA or gag CA (Fig. 3,A). The presence of cytoskeletal proteins in these immunoprecipitates was then determined by Western blotting with antibodies to cytoskeletal proteins including actin (microfilaments), vimentin (intermediate filaments), or tubulin (microtubules) and to gag MA and gag CA as outlined in Fig. 3,A. Antibodies to actin reacted with gag MA immunoprecipitates from HIV-1– infected cells at 100, 300, and 800 mM NaCl, suggesting a tight interaction between actin and gag MA (Fig. 3,B). Gag MA immunoprecipitates from uninfected cells also reacted with actin antibody but only at 100 mM NaCl, likely a result of a nonspecific interaction between actin and a cellular protein within gag MA immunoprecipitates (Fig. 3,B). In comparison, antibodies to actin bound to gag CA immunoprecipitates prepared in 100 mM NaCl but not in 300 or 800 mM NaCl. This weak interaction was again nonspecific since it was evident in both infected and uninfected cells (Fig. 3,B). No reactivity of gag MA or gag CA immunoprecipitates was noted with antibodies to vimentin or to tubulin (Fig. 3,B), suggesting that there was no association between these proteins in acutely infected cells. Each antibody recognized its cognate protein at all NaCl concentrations, indicating that the high salt immunoprecipitation conditions did not compromise antibody reactivity (Fig. 3 C). Collectively, these results suggest that gag MA associates with actin during early stages of HIV-1 infection.

Efficient Reverse Transcription of HIV-1 Nucleic Acids Involves the Cytoskeleton.

To determine whether the cytoskeletal association of viral reverse transcription complexes influenced the function of this complex, we initially determined whether cytoskeletal depolymerizing agents influenced cDNA synthesis within the complex. According to current models of reverse transcription (48), the earliest viral cDNA detectable in the cell after fusion and uncoating is minus-strand strong-stop cDNA which spans the R-U5 region of the viral LTR (Fig. 4,A), whereas a late step in reverse transcription involves synthesis of plus-strand DNA spanning the LTR U5/gag boundary (Fig. 4,A). Thus, LTR R-U5 products represent a marker with which to gauge the extent of virus entry and early reverse transcription, whereas LTR U5-gag products provide an indicator of the extent of late reverse transcription in the infected cell (37). CCD (5 μM) was added to cells 1 h before or 2 h after virus infection. Cells were harvested 4 h after virus infection for isolation of viral nucleic acids from membrane/ cytosol, cytoskeletal, and nuclear extracts. Early (LTR R-U5) and late (LTR U5-gag) cDNA products of reverse transcription in these extracts were analyzed by PCR under limiting dilution conditions. In untreated (control) cells, early reverse transcripts were detectable in all subcellular fractions (Fig. 4,B). Surprisingly, late products of reverse transcription were found only in cytoskeletal and nuclear fractions but were absent from membrane/cytosol extracts (Fig. 4,B). When added 1 h before infection, CCD reduced the amount of early reverse transcripts in all fractions by approximately four- to fivefold (Fig. 4,B). Late products were not detectable in the cytoskeleton of CCD-treated cultures, whereas in the nucleus their abundance was reduced by ∼25-fold (Fig. 4,B). In contrast, addition of CCD to cells 2 h after virus infection had no effect on abundance of either early or late products of reverse transcription in any cell fraction (Fig. 4,B). Both early and late cDNA products were the result of de novo reverse transcription rather than virion-associated cDNA products, since the amount of PCR products was markedly reduced in cultures that had been pretreated with the reverse transcriptase inhibitor, AZT (Fig. 4,B). The results suggest that steps in virus entry leading up to initiation of reverse transcription (fusion/uncoating, activation of the reverse transcription complex) involve the cytoskeleton. The results further indicate that the reverse transcription process is localized primarily on the cytoskeleton and that efficient synthesis of late cDNA transcripts requires the presence of actin microfilaments. This interaction with the cytoskeleton appears to be initiated early upon infection and is also irreversible, since addition of CCD to cells after virus infection did not compromise the reverse transcription process (Fig. 4 B).

Efficient HIV-1 Infection Requires an Intact Cytoskeleton.

A confounding factor in experiments that examine early events in the virus life cycle is that much of the viral material present in the inoculum is noninfectious. Thus, it is possible that the viral nucleic acids and proteins found in association with the cytoskeleton may not be the component of the inoculum that was actually mediating bona fide virus infection. To address this issue, we examined the effects of cytoskeletal inhibitors on HIV-1 infection. After completion of reverse transcription, viral nucleic acids integrate into host cell DNA, leading to the formation of a “provirus” from which genomic and subgenomic viral transcripts are derived. Therefore, we examined the effects of cytoskeletal inhibitors on provirus establishment in a single-cycle Magi infectivity assay (35). We initially determined drug concentrations required to impair organization of their cognate cytoskeletal targets in Magi cells (Fig. 5,A). In adherent cells, actin is organized in “stress fibers” of polymerized actin microfilaments (Fig. 5,A). Treatment of cells with cytochalasins A, D, and E (5 μM) led to a collapse of actin microfilaments into condensed bundles of monomeric actin that was randomly distributed through the cell cytoplasm (Fig. 5,A). This concentration of cytochalasin did not compromise cell viability during the course of the experiment (not shown). Complete disruption of actin microfilaments typically occurred within 1 h of drug addition. All three cytochalasins (CCA, CCD, and CCE) markedly impaired viral infectivity when added 2 h before (2h pre) virus infection (Fig. 5,B). In contrast, the drugs did not significantly affect HIV-1 infectivity when added 2 h after (2h post) virus infection, and in some cases enhanced infection (Fig. 5,B). Thus, the inhibitory effects of the cytochalasins on HIV-1 infectivity were not due, for example, to indirect effects of the drugs on host cell viability. This pattern of inhibition is in strong agreement with the effect of these inhibitors on the association of gag MA with the cytoskeleton (Figs. 2 and 3) and on reverse transcription (Fig. 4) in MT-4 cells, in that CCD was inhibitory when added at least 1 h before but not after virus infection. We next determined whether there was a concomitant effect on the reverse transcription process in Magi cells. Early (LTR R-U5) and late (LTR U5-gag) products of reverse transcription were quantitated at different intervals after infection (Fig. 6). Treatment of CCD only slightly impaired the levels of minus-strand strong-stop cDNA in all fractions (Fig. 6). In agreement with the pattern observed in MT-4 cells, late products of reverse transcription were evident only in the cytoskeleton and the nucleus. However, pretreatment of the cells with CCD delayed the appearance of late products of reverse transcription (Fig. 6). In untreated cells, late products of reverse transcription were detectable in the cytoskeleton and the nucleus at 1 and 3 h after infection, respectively. After CCD treatment, late reverse transcription products could not be detected until 5 h after infection (Fig. 6). In contrast to the inhibitory effects of cytochalasins on HIV-1 entry, the microtubule disrupting agent, nocodazole, had a very modest inhibitory effect on HIV-1 infectivity in several independent experiments (Fig. 7). Although a slight inhibitory effect on HIV-1 infectivity was observed at lower levels of virus inoculum, these effects were equally apparent whether nocodazole was added before or after HIV-1 infection. Since nocodazole had no effect on the interaction between gag MA and the cytoskeleton or on the abundance of gag MA in the acutely infected cell (Fig. 2 B), it is unlikely that nocodazole is directly influencing establishment of the reverse transcription complex. Since the slight inhibitory effect was evident when the inhibitor was added before and after virus infection, we cannot exclude the possibility that nocodazole influenced the infectivity assay indirectly through its effect on host cell function. Collectively, these results indicate that the reverse transcription process in a newly infected cell is localized to the host cell cytoskeleton and that intact actin microfilaments are necessary for efficient reverse transcription.

Actin–Myosin Interaction Influences HIV-1 Infection.

Translational movement along actin microfilaments is mediated by myosins (for a review, see reference 49). Myosin function is regulated by phosphorylation of the regulatory light chains by myosin light-chain kinase (50), which promotes myosin ATPase activity and polymerization of actin cables (51, 52). ML7 (53) and KT5926 (54; both obtained from Calbiochem Corp., La Jolla, CA) are well-described inhibitors of myosin light-chain kinase (Ki; 21 μM and 18 nM, respectively). Inhibition of myosin light-chain phosphorylation inhibits myosin-mediated translational movement. Thus, we examined whether HIV-1 infectivity was sensitive to agents that affect myosin-mediated translational movement along actin microfilaments. The myosin light-chain kinase inhibitors ML7 (Fig. 8,A) and KT5926 (Fig. 8,B) both impaired viral infectivity. This inhibition was similar to that observed with cytochalasins, in that ML7 inhibited HIV-1 infection when added 2 h before virus infection, but not 2 h after infection. Subcellular distribution of viral reverse transcription complexes in cells treated with KT5926 was determined in order to identify at which point the inhibition of infectivity was manifest. Pretreatment of cells with increasing concentrations of KT5926 between 100 and 500 nM resulted in a gradual decrease in the amount of gag MA that localized to the host cell nucleus, while there was a corresponding increase in the level of gag MA in the cytoskeletal fraction (Fig. 8,C). One explanation for this result is that inhibition of myosin phosphorylation delays the transit of viral reverse transcription complexes from the cytoskeleton to the nucleus. KT5926 also reduced the amount of gag MA that was present in the cytosol and membrane fractions by ∼30%, indicating that viral uptake was also being influenced (Fig. 8 C). However, this modest effect on gag MA uptake was not dose dependent and was unlikely to account for the rather dramatic effect of this inhibitor on virus infection. Thus, although additional effects of the inhibitor on virus uptake cannot be excluded, the inhibitory profiles are more consistent with the hypothesis that the effects of the inhibitor on gag MA redistribution between cytoskeletal and nuclear fractions account for the majority of the inhibitory effects on virus infection.

The Host Cell Cytoskeleton Is Important for HIV-1 Entry by Fusion but not by Endocytosis.

HIV-1 entry is mediated by pH-independent fusion between viral and host cell membranes (55). When HIV-1 virion cores are pseudotyped with envelope proteins of VSV, infection is mediated by endocytosis (35, 56). Thus, we compared the relative cytoskeletal requirements for virus entry via the fusion and endocytosis routes. In contrast to the marked effects of CCD on wild-type HIV-1 infection (Fig. 5,B), CCD had no significant effect on entry of VSV-pseudotyped HIV-1 when added before virus inoculation (Fig. 9,A). Similarly, CCD had no effect on the association of gag MA with the cytoskeleton (Fig. 9,B). Although a slight inhibitory effect on virus infection was evident in cultures in which the inhibitor was added 2 h after virus inoculation (Fig. 9 A), this very slight effect was not consistent over several independent infectivity experiments and likely fell within the variability of the single-cycle infectivity assay. These results suggest that cytoskeletal association can be uncoupled from infectivity when HIV-1 entry is mediated by endocytosis. It is possible that engagement of the cytoskeleton is coupled to fusion, which places the reverse transcription complex in an appropriate context within the acutely infected cell (i.e., in association with the cytoskeleton). The experiments also indicate that, upon establishment of a functional reverse transcription complex within the cell (whether after fusion or endocytosis), events in the viral life cycle leading up to de novo gene expression from the integrated provirus do not require actin microfilaments.

Discussion

The results outlined in this study suggest that an essential early event in the virus life cycle, namely establishment of the viral reverse transcription complex, is promoted by actin microfilaments of the host cell cytoskeleton. During preparation of this manuscript, Iyengar et al. (57) demonstrated that HIV-1 infection of primary T cells could be completely inhibited by treatment of cells with CCD. The investigators went on to demonstrate that colocalization of the HIV-1 receptors, CD4 and CXCR4, on primary T cells required actin, and suggested that actin is necessary for a step leading up to fusion between viral and host cell membranes. However, the results presented here clearly indicate that the inhibitory effects of the cytochalasins in T cells and Magi cells can only be partly accounted for by inhibition of a step leading up to entry of the reverse transcription complex. In the experiments presented here, minus-strand strong-stop cDNA was detected in CCD-treated T cells and Magi cells which completely lack actin microfilaments. Our results indicate that the reverse transcription complex rapidly associates with actin microfilaments and that efficient reverse transcription is dependent on the presence of actin microfilaments. Our results also suggest that actin microfilaments of the host cell cytoskeleton are a major site for reverse transcription in the infected cell. Although actin depolymerization did not significantly affect the presence of early reverse transcription products in the cytoskeleton and in the nucleus, these early reverse transcription products did not go on to complete reverse transcription if actin polymerization was inhibited before virus infection. This suggests that interaction with actin microfilaments is an essential intermediate step that is required for efficient reverse transcription, and early reverse transcripts that bypass this intermediate step still translocate to the nucleus but are incapable of undergoing complete reverse transcription. The basis for the dependence of an intact cytoskeleton for efficient reverse transcription is unclear at present, and we know of no precedent in the animal oncoretrovirus or primate lentivirus systems to explain this dependence. Cytoskeletal proteins have also been implicated in the activation of transcription of paramyxoviruses (measles virus, Sendai virus, respiratory syncytial virus) and rhabdoviruses (VSV) (5860). For example, in paramyxoviruses such as human parainfluenza virus type 3, polymerized actin has been shown to be necessary for the activation of transcription from the ribonucleoprotein complex in vitro and in vivo (6163). It has been suggested that upon interaction with actin, the paramyxovirus ribonucleoprotein complex undergoes a conformational alteration from a loosely coiled to a moderately condensed form, which facilitates transcription (62). It is possible that activation of HIV-1 reverse transcription also requires a conformational change in the reverse transcription complex, and that this is mediated through interaction with the actin microfilaments. Although there is no direct evidence to suggest that activation of the reverse transcription complex requires interaction with the cytoskeleton, such a model is suggested by the demonstration that the large subunit of HIV-1 reverse transcriptase interacts with β-actin (64). Although this interaction has been implicated in promoting the release of virus particles from the infected cell, in light of our current findings it is tempting to speculate that such an interaction may provide the basis by which association with actin microfilaments was required for efficient reverse transcription. Alternatively, the uncoating process itself may be facilitated by association of the incoming capsid core with the cytoskeleton, due to the interaction between capsid protein and actin. However, the results presented here would favor the former hypothesis in that gag MA within the reverse transcription complex associated with actin, whereas capsid, the major component of the viral core, did not exhibit any significant binding. The infectious virus particle does not contain all the components necessary for efficient completion of cDNA synthesis, since only early reverse transcription products are reconstituted in in vitro reverse transcription reactions using extracts from disrupted virions (for a review, see reference 65). Thus, it is also possible that the cytoskeleton is a favored site for reverse transcription because cellular factors important in the reverse transcription process may also localize to the cytoskeleton.

VSV-G envelope–pseudotyped HIV-1 entry was independent of actin microfilaments, suggesting that virus entry by endocytosis circumvents the aspect of the virus life cycle that requires cytoskeletal interaction. Entry of pseudotyped HIV-1 by endocytosis requires an acidification step which promotes fusion between the viral membrane and the membrane of the endocytic vesicle (56). It is possible that the low pH environment of the endosome may also alter conformation of the viral reverse transcription complex in a way that obviates the requirement for actin in this process. By analogy, the requirement for actin microfilaments in the entry of MLV also depends on the route of virus entry. MLV infection of NIH 3T3 cells occurs by endocytosis, whereas that of XC Sarcoma cells proceeds by surface fusion. Both entry mechanisms are dependent on polymerized actin, implicating a critical role for this network in an early step common to both entry pathways, perhaps at the level of receptor clustering (66, 67). However, events in the entry process subsequent to virus uptake via endocytosis, but not by fusion, were dependent on intact microtubules, implicating the microtubule component of the cytoskeleton in a postpenetration step (67).

Previous studies have implicated the host cell cytoskeleton in late events in the virus life cycle. The release of HIV-1 from polarized cells was shown to be dependent on an intact cytoskeleton (68), whereas inhibitors of myosin light-chain kinase and actin polymerization inhibited the release of HIV-1 from the infected cells (69). Polymerized actin has been implicated in directional budding of HIV-1 from infected monocytes as evidenced by colocalization of actin and gag CA protein at the sites of virus release (23). A role for the cytoskeleton in virus release was also suggested by the observation that HIV-1 gag polyprotein associated with polymerized actin (47) and that HIV-1 virions contain actin in a 10% molar ratio relative to gag polyproteins (70). The accessory gene product, Vif, which has an important role in the regulation of virus infectivity, has been proposed to regulate virus maturation by mediating interaction with the cellular cytoskeleton (71). The role of gag–cytoskeleton interaction in virus maturation may be paradoxical with the potential role of gag MA–cytoskeletal interaction during virus entry. Presumably, the interaction between gag precursor proteins and the cytoskeleton at late stages in the virus life cycle would favor accumulation of virion precursor proteins at the cell surface, which is necessary for efficient budding from the infected cell. However, as shown in this study, at early stages in the virus life cycle this interaction appears to be promoting the establishment of infection after virus uptake. Our data suggest that phosphorylated gag MA proteins of the virion associate with the cytoskeleton. This differential phosphorylation likely dictates the fate of the replication intermediates that have associated with the cytoskeleton. We have previously suggested a model in which gag MA phosphorylation regulates the opposing targeting properties of this protein during virus assembly and during virus entry (10, 14).

Recent studies have suggested that nuclear targeting of incoming human foamy virus proteins was dependent on the presence of intact microtubules (72). Similar to the localization of viral reverse transcription complexes to actin microfilaments outlined here, the study of Saib et al. (72) demonstrated aggregation of viral reverse transcription complexes on microtubules. That study also suggested that virus entry was not dependent on microtubules but that a subsequent step, either at the level of reverse transcription or nuclear import, was microtubule dependent and highly sensitive to colchicine, a microtubule-disrupting agent. These results are reminiscent of observations in other viral systems such as herpes simplex, where transport of incoming viral capsids to the nucleus is mediated by microtubules (73). Intriguingly, recent studies in our laboratory (our unpublished results) suggest that intermediate filaments, another component of the cytoskeleton, do not appear to be involved in events leading up to completion of viral cDNA synthesis on the cytoskeleton but may be important for subsequent translocation of nascent viral reverse transcription complexes to the host cell nucleus.

Acknowledgments

We thank M. Emerman for the pSfi clone and the VSV-G expression vector, S. Doxsey for guidance in the cytoskeletal analysis, and L. Henderson for the rabbit anti–HIV-1 gag MA antisera. Magi cells, 293T cells, and MT-4 T cells were provided by the National Institutes of Health AIDS Research and Reference Reagent Program (National Institute of Allergy and Infectious Diseases, Bethesda, MD).

This work was supported by grants from the National Institutes of Health and the Fogarty Program to M. Stevenson.

Abbreviations used in this paper

     
  • CA

    capsid

  •  
  • CCA

    CCD, and CCE, cytochalasin A, D, and E, respectively

  •  
  • FBS

    fetal bovine serum

  •  
  • MA

    matrix

  •  
  • MLV

    murine leukemia virus

  •  
  • VSV

    vesicular stomatitis virus

References

References
1
Dragic, T., A. Trkola, and J.P. Moore. 1997. HIV co-receptors: gateways to the cell. In HIV Advances in Research and Therapy. Vol. 7. T.C. Merigan, D.P. Bolognesi, J. Feinberg, P.A. Volberding, and F. Wong-Staal, editors. Cliggott Communications, Greenwich, CT. 3–12.
2
Bukrinsky
M
,
Haggerty
S
,
Dempsey
MP
,
Sharova
N
,
Adzhubei
A
,
Spitz
L
,
Lewis
P
,
Goldfarb
D
,
Emerman
M
,
Stevenson
M
A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells
Nature
1993
365
666
669
[PubMed]
3
Bukrinsky
MI
,
Sharova
N
,
McDonald
TL
,
Pushkarskaya
T
,
Tarpley
WG
,
Stevenson
M
Association of integrase, matrix, and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection
Proc Natl Acad Sci USA
1993
90
6125
6129
[PubMed]
4
Karageorgos
L
,
Li
P
,
Burrell
C
Characterization of HIV replication complexes early after cell-to-cell infection
AIDS Res Hum Retroviruses
1993
9
817
823
[PubMed]
5
Heinzinger
N
,
Bukrinsky
M
,
Haggerty
S
,
Ragland
A
,
Lee
M-A
,
Kewalramani
V
,
Gendelman
H
,
Ratner
L
,
Stevenson
M
,
Emerman
M
The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in nondividing host cells
Proc Natl Acad Sci USA
1994
91
7311
7315
[PubMed]
6
Gallay
P
,
Swingler
S
,
Aiken
C
,
Trono
D
HIV-1 infection of nondividing cells: C-terminal tyrosine phosphorylation of the viral matrix protein is a key regulator
Cell
1995
80
379
388
[PubMed]
7
Miller
MD
,
Farnet
CM
,
Bushman
FD
Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition
J Virol
1997
71
5382
5390
[PubMed]
8
Farnet
CM
,
Haseltine
WA
Determination of viral proteins present in the human immunodeficiency virus type 1 preintegration complex
J Virol
1991
65
1910
1915
[PubMed]
9
Stevenson
M
Portals of entry: uncovering HIV nuclear transport pathways
Trends Cell Biol
1996
6
9
15
[PubMed]
10
Bukrinskaya
AG
,
Ghorpade
A
,
Heinzinger
NK
,
Smithgall
TE
,
Lewis
RE
,
Stevenson
M
Phosphorylation-dependent human immunodeficiency virus type 1 infection and nuclear targeting of viral DNA
Proc Natl Acad Sci USA
1996
93
367
371
[PubMed]
11
Gheysen
D
,
Jacobs
E
,
de Foresta
F
,
Thiriart
C
,
Francotte
M
,
Thines
D
,
De Wilde
M
Assembly and release of HIV-1 precursor Pr55gagvirus-like particles from recombinant baculovirus-infected insect cells
Cell
1989
59
103
112
[PubMed]
12
Gottlinger
HG
,
Sodroski
JG
,
Haseltine
WA
Role of capsid precursor processing and myristoylation in morphogenesis and infectivity of human immunodeficiency virus type 1
Proc Natl Acad Sci USA
1989
86
5781
5785
[PubMed]
13
Bryant
M
,
Ratner
L
Myristoylation-dependent replication and assembly of human immunodeficiency virus 1
Proc Natl Acad Sci USA
1990
87
523
527
[PubMed]
14
Jacqué
J-M
,
Mann
A
,
Enslen
H
,
Sharova
N
,
Brichacek
B
,
Davis
RJ
,
Stevenson
M
Modulation of HIV-1 infectivity by MAPK, a virion-associated kinase
EMBO (Eur Mol Biol Organ) J
1998
17
2607
2618
[PubMed]
15
Von Schwedler
U
,
Kornbluth
RS
,
Trono
D
The nuclear localization signal of the matrix protein of human immunodeficiency virus type 1 allows the establishment of infection in macrophages and quiescent T lymphocytes
Proc Natl Acad Sci USA
1994
91
6992
6996
[PubMed]
16
Freed
EO
,
Orenstein
JM
,
Buckler-White
AJ
,
Martin
MA
Single amino acid changes in the human immunodeficiency virus type 1 matrix protein block virus particle production
J Virol
1994
68
5311
5320
[PubMed]
17
Fouchier
RA
,
Meyer
BE
,
Simon
JH
,
Fischer
U
,
Malim
MH
HIV-1 infection of non-dividing cells: evidence that the amino-terminal basic region of the viral matrix protein is important for Gag processing but not for post-entry nuclear import
EMBO (Eur Mol Biol Organ) J
1997
16
4531
4539
[PubMed]
18
Gallay
P
,
Hope
T
,
Chin
D
,
Trono
D
HIV-1 infection of nondividing cells through the recognition of integrase by the importin/karyopherin pathway
Proc Natl Acad Sci USA
1997
94
9825
9830
[PubMed]
19
Vodicka
MA
,
Koepp
DM
,
Silver
PA
,
Emerman
M
HIV-1 Vpr interacts with the nuclear transport pathway to promote macrophage infection
Genes Dev
1998
12
175
185
[PubMed]
20
Nie
Z
,
Bergeron
D
,
Subbramanian
RA
,
Yao
XJ
,
Checroune
F
,
Rougeau
N
,
Cohen
EA
The putative alpha helix 2 of human immunodeficiency virus type 1 Vpr contains a determinant which is responsible for the nuclear translocation of proviral DNA in growth-arrested cells
J Virol
1998
72
4104
4115
[PubMed]
21
Subbramanian
RA
,
Kessous-Elbaz
A
,
Lodge
R
,
Forget
J
,
Yao
XJ
,
Bergeron
D
,
Cohen
EA
Human immunodeficiency virus type 1 Vpr is a positive regulator of viral transcription and infectivity in primary human macrophages
J Exp Med
1998
187
1103
1111
[PubMed]
22
Subbramanian
RA
,
Yao
XJ
,
Dilhuydy
H
,
Rougeau
N
,
Bergeron
D
,
Robitaille
Y
,
Cohen
EA
Human immunodeficiency virus type 1 Vpr localization: nuclear transport of a viral protein modulated by a putative amphipathic helical structure and its relevance to biological activity
J Mol Biol
1998
278
13
30
[PubMed]
23
Perotti
ME
,
Tan
X
,
Phillips
DM
Directional budding of human immunodeficiency virus from monocytes
J Virol
1996
70
5916
5921
[PubMed]
24
Bowerman
B
,
Brown
PO
,
Bishop
JM
,
Varmus
HE
A nucleoprotein complex mediates the integration of retroviral DNA
Genes Dev
1989
3
469
478
[PubMed]
25
Lori
F
,
di Marzo
VF
,
de Vico
AL
,
Lusso
P
,
Reitz
MSJ
,
Gallo
RC
Viral DNA carried by human immunodeficiency virus type 1 virions
J Virol
1992
66
5067
5074
[PubMed]
26
Trono
D
Partial reverse transcripts in virions from human immunodeficiency and murine leukemia viruses
J Virol
1992
66
4893
4900
[PubMed]
27
Zhang
H
,
Zhang
Y
,
Spicer
T
,
Henrard
D
,
Poiesz
BJ
Nascent human immunodeficiency virus type 1 reverse transcription occurs within an enveloped particle
J Virol
1995
69
3675
3682
[PubMed]
28
Preston
BD
,
Poiesz
BJ
,
Loeb
LA
Fidelity of HIV-1 reverse transcriptase
Science
1988
242
1168
1171
[PubMed]
29
Bukrinsky
MI
,
Sharova
N
,
Dempsey
MP
,
Stanwick
TL
,
Bukrinskaya
AG
,
Haggerty
S
,
Stevenson
M
Active nuclear import of human immunodeficiency virus type 1 preintegration complexes
Proc Natl Acad Sci USA
1992
89
6580
6584
[PubMed]
30
Brown
PO
,
Bowerman
B
,
Varmus
HE
,
Bishop
JM
Correct integration of retroviral DNA in vitro.
Cell
1987
49
347
356
[PubMed]
31
Roe
T
,
Reynolds
TC
,
Yu
G
,
Brown
PO
Integration of murine leukemia virus DNA depends on mitosis
EMBO (Eur Mol Biol Organ) J
1993
12
2099
2108
[PubMed]
32
Lewis
PF
,
Emerman
M
Passage through mitosis is required for oncoretroviruses but not for the human immunodeficiency virus
J Virol
1994
68
510
516
[PubMed]
33
Pear
WS
,
Nolan
GP
,
Scott
ML
,
Baltimore
D
Production of high-titer helper-free retroviruses by transient transfection
Proc Natl Acad Sci USA
1993
90
8392
8396
[PubMed]
34
Peden
K
,
Emerman
M
,
Montagnier
L
Changes in growth properties on passage in tissue culture of viruses derived from infectious molecular clones of HIV-1LAI, HIV-1MAL, and HIV-1ELI
Virology
1991
185
661
672
[PubMed]
35
Kimpton
J
,
Emerman
M
Detection of replication-competent and pseudotyped human immunodeficiency virus with a sensitive cell line on the basis of activation of an integrated beta-galactosidase gene
J Virol
1992
66
2232
2239
[PubMed]
36
Bartz
SR
,
Rogel
ME
,
Emerman
M
Human immunodeficiency virus type 1 cell cycle control: Vpr is cytostatic and mediates G2accumulation by a mechanism which differs from DNA damage checkpoint control
J Virol
1996
70
2324
2331
[PubMed]
37
Zack
JA
,
Arrigo
SJ
,
Weitsman
SR
,
Go
AS
,
Haislip
A
,
Chen
ISY
HIV-1 entry into quiescent primary lymphocytes: molecular analysis reveals a labile, latent viral structure
Cell
1990
61
213
222
[PubMed]
38
Folks
TM
,
Powell
D
,
Lightfoote
M
,
Koenig
S
,
Fauci
AS
,
Benn
S
,
Rabson
A
,
Daugherty
D
,
Gendelman
HE
,
Hoggan
MD
et al
Biological and biochemical characterization of a cloned LEU-3−cell surviving infection with the acquired immune deficiency syndrome retrovirus
J Exp Med
1986
164
280
290
[PubMed]
39
Myers, G., J. Berzofsky, B. Korber, R.F. Smith, and G.N. Pavlakis. 1993. Human retroviruses and AIDS 1993: a compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics Group T-10, Los Alamos National Laboratory, Los Alamos, NM.
40
Lochrie
MA
,
Waugh
S
,
Pratt
DG
Jr
,
Clever
J
,
Parslow
TG
,
Polisky
B
In vitro selection of RNAs that bind to the human immunodeficiency virus type-1 gag polyprotein
Nucleic Acids Res
1997
25
2902
2910
[PubMed]
41
Geppert
TD
,
Lipsky
PE
Association of various T cell-surface molecules with the cytoskeleton. Effect of cross-linking and activation
J Immunol
1991
146
3298
3305
[PubMed]
42
Kinch
MS
,
Strominger
JL
,
Doyle
C
Cell adhesion mediated by CD4 and MHC class II proteins requires active cellular processes
J Immunol
1993
151
4552
4561
[PubMed]
43
Miranda
AF
,
Godman
GC
,
Deitch
AD
,
Tanenbaum
SW
Action of cytochalasin D on cells of established lines. I. Early events
J Cell Biol
1974
61
481
500
[PubMed]
44
Brown
SS
,
Spudich
JA
Mechanism of action of cytochalasin: evidence that it binds to actin filament ends
J Cell Biol
1981
88
487
491
[PubMed]
45
Dellagi
K
,
Brouet
JC
Redistribution of intermediate filaments during capping of lymphocyte surface molecules
Nature
1982
298
284
286
[PubMed]
46
De Brabander
MJ
,
Van de Veire
RM
,
Aerts
FE
,
Borgers
M
,
Janssen
PA
The effects of methyl (5-(2-thienylcarbonyl)-1H-benzimidazol-2-yl) carbamate, (R 17934; NSC 238159), a new synthetic antitumoral drug interfering with microtubules, on mammalian cells cultured in vitro
Cancer Res
1976
36
905
916
[PubMed]
47
Rey
O
,
Canon
J
,
Krogstad
P
HIV-1 gag protein associates with F-actin present in microfilaments
Virology
1996
220
530
534
[PubMed]
48
Coffin, J.M. 1996. Retroviridae: the viruses and their replication. In Fields Virology, 3rd ed. Vol. 2. B.N. Fields, D.M. Knipe, P.M. Howley, R.M. Chanock, J.L. Melnick, T.P. Monath, B. Roizman, and S.E. Straus, editors. Lippincott-Raven Publishers, Philadelphia. 1767–1847.
49
Mitchison
TJ
,
Kramer
LP
Actin-based cell motility and cell locomotion
Cell
1996
84
371
379
[PubMed]
50
Adelstein
RS
Regulation of contractile proteins by phosphorylation
J Clin Invest
1983
72
1863
1866
[PubMed]
51
Wilson
AK
,
Gorgas
G
,
Claypool
WD
,
de Lanerolle
P
An increase or a decrease in myosin II phosphorylation inhibits macrophage motility
J Cell Biol
1991
114
277
283
[PubMed]
52
Jay
PY
,
Pham
PA
,
Wong
SA
,
Elson
EL
A mechanical function of myosin II in cell motility
J Cell Sci
1995
108
387
393
[PubMed]
53
Saitoh
M
,
Ishikawa
T
,
Matsushima
S
,
Naka
M
,
Hidaka
H
Selective inhibition of catalytic activity of smooth muscle myosin light-chain kinase
J Biol Chem
1987
262
7796
7801
[PubMed]
54
Nakanishi
S
,
Yamada
K
,
Iwahashi
K
,
Kuroda
K
,
Kase
H
KT5926, a potent and selective inhibitor of myosin light-chain kinase
Mol Pharmacol
1990
37
482
488
[PubMed]
55
Stein
BS
,
Gowda
SD
,
Lifson
JD
,
Penhallow
RC
,
Bensch
KG
,
Engleman
EG
pH-independent HIV entry into CD4-positive T cells via virus envelope fusion to the plasma membrane
Cell
1987
49
659
668
[PubMed]
56
Aiken
C
Pseudotyping human immunodeficiency virus type 1 (HIV-1) by the glycoprotein of vesicular stomatitis virus targets HIV-1 entry to an endocytic pathway and suppresses both the requirement for Nef and the sensitivity to cyclosporin A
J Virol
1997
71
5871
5877
[PubMed]
57
Iyengar
S
,
Hildreth
JEK
,
Schwartz
DH
Actin-dependent receptor colocalization required for human immunodeficiency virus entry into host cells
J Virol
1998
72
5251
5255
[PubMed]
58
Moyer
SA
,
Baker
SC
,
Lessard
JL
Tubulin: a factor necessary for the synthesis of both Sendai virus and vesicular stomatitis virus RNAs
Proc Natl Acad Sci USA
1986
83
5405
5409
[PubMed]
59
Hill
VM
,
Summers
DF
A minor microtubule-associated protein is responsible for the stimulation of vesicular stomatitis virus transcription in vitro
J Virol
1990
71
289
298
60
Huang
YT
,
Romito
RR
,
De
BP
,
Banerjee
AK
Characterization of the in vitrosystem for the synthesis of mRNA from human respiratory syncytial virus
Virology
1993
193
862
867
[PubMed]
61
De
BP
,
Lesoon
A
,
Banerjee
AK
Human parainfluenza virus type 3 transcription in vitro: role of cellular actin in mRNA synthesis
J Virol
1991
65
3268
3275
[PubMed]
62
De
BP
,
Burdsall
AL
,
Banerjee
AK
Role of cellular actin in human parainfluenza virus type 3 genome transcription
J Biol Chem
1993
268
5703
5710
[PubMed]
63
Gupta
S
,
De
BP
,
Drazba
JA
,
Banerjee
AK
Involvement of actin microfilaments in the replication of human parainfluenza virus type 3
J Virol
1998
72
2655
2662
[PubMed]
64
Hottiger
M
,
Gramatikoff
K
,
Georgiev
O
,
Chaponnier
C
,
Schaffner
W
,
Hubscher
U
The large subunit of HIV-1 reverse transcriptase interacts with beta-actin
Nucleic Acids Res
1995
23
736
741
[PubMed]
65
Arts
EJ
,
Wainberg
MA
Human immunodeficiency virus type 1 reverse transcriptase and early events in reverse transcription
Adv Virus Res
1996
46
97
163
[PubMed]
66
Woodard
MH
,
Dunn
WA
,
Laine
RO
,
Malandro
M
,
McMahon
R
,
Simell
O
,
Block
ER
,
Kilberg
MS
Plasma membrane clustering of the system y+ (CAT-1) amino acid transporter as detected by immunohistochemistry
Am J Physiol
1994
266
E817
E824
[PubMed]
67
Kizhatil
K
,
Albritton
LM
Requirements for different components of the host cell cytoskeleton distinguish ecotropic murine leukemia virus entry via endocytosis from entry via surface fusion
J Virol
1997
71
7145
7156
[PubMed]
68
Pearce-Pratt
R
,
Malamud
D
,
Phillips
DM
Role of the cytoskeleton in cell-to-cell transmission of human immunodeficiency virus
J Virol
1994
68
2898
2905
[PubMed]
69
Sasaki
H
,
Nakamura
M
,
Ohno
T
,
Matsuda
Y
,
Yuda
Y
,
Nonomura
Y
Myosin-actin interaction plays an important role in human immunodeficiency virus type 1 release from host cells
Proc Natl Acad Sci USA
1995
92
2026
2030
[PubMed]
70
Ott
DE
,
Coren
LV
,
Kane
BP
,
Busch
LK
,
Johnson
DG
,
Sowder
RC
II
,
Chertova
EN
,
Arthur
LO
,
Henderson
LE
Cytoskeletal proteins inside human immunodeficiency virus type 1 virions
J Virol
1996
70
7734
7743
[PubMed]
71
Karczewski
MK
,
Strebel
K
Cytoskeleton association and virion incorporation of the human immunodeficiency virus type 1 Vif protein
J Virol
1996
70
494
507
[PubMed]
72
Saib
A
,
Puvion-Dutilleul
F
,
Schmid
M
,
Peries
J
,
de The
H
Nuclear targeting of incoming human foamy virus Gag proteins involves a centriolar step
J Virol
1997
71
1155
1161
[PubMed]
73
Sodeik
B
,
Ebersold
MW
,
Helenius
A
Microtubule-mediated transport of incoming herpes simplex virus 1 capsids to the nucleus
J Cell Biol
1997
136
1007
1021
[PubMed]

A. Bukrinskaya and B. Brichacek contributed equally to this study.

Author notes

Address correspondence to Mario Stevenson, Department of Molecular Genetics and Microbiology, Program in Molecular Medicine, University of Massachusetts Medical Center, 373 Plantation St., Worcester, MA 01605. Phone: 508-856-4582; Fax: 508-856-4075.