The structurally related T cell surface molecules CD28 and CTLA-4 interact with cell surface ligands CD80 (B7-1) and CD86 (B7-2) on antigen-presenting cells (APC) and modulate T cell antigen recognition. Preliminary reports have suggested that CD80 binds CTLA-4 and CD28 with affinities (Kd values ∼12 and ∼200 nM, respectively) that are high when compared with other molecular interactions that contribute to T cell–APC recognition. In the present study, we use surface plasmon resonance to measure the affinity and kinetics of CD80 binding to CD28 and CTLA-4. At 37°C, soluble recombinant CD80 bound to CTLA-4 and CD28 with Kd values of 0.42 and 4 μM, respectively. Kinetic analysis indicated that these low affinities were the result of very fast dissociation rate constants (koff); sCD80 dissociated from CD28 and CTLA-4 with koff values of ⩾1.6 and ⩾0.43 s−1, respectively. Such rapid binding kinetics have also been reported for the T cell adhesion molecule CD2 and may be necessary to accommodate dynamic T cell–APC contacts and to facilitate scanning of APC for antigen.

CD28 (1, 2) and CTLA-4 (3) are structurally related cell surface molecules, largely restricted to the T cell lineage, which contribute to antigen recognition by T cells (for reviews see references 46). They do so by interacting with the structurally related ligands CD80 (B7-1, B7; 7, 8) and CD86 (B7-2, B70; 9–12), which are expressed on APC. Numerous reports (reviewed in references 46) have shown that, upon ligation, CD28 transmits activation signals that enhance T cell activation through the TCR. The role of CTLA-4 is more controversial (13), but recent in vivo studies (1416) suggest that, unlike CD28, CTLA-4 ligation inhibits T cell activation, apparently by inhibiting signaling through the TCR (17).

Antigen recognition by T cells is unusual in that it occurs at the interface between two cells in direct physical contact, and CD28 is one of several T cell surface molecules that participate in this interaction (18, 19). It is becoming evident that T cells are sensitive to quantitative changes in the molecular interactions that contribute to T cell antigen recognition, and that quantitative differences in, for example, binding affinity, kinetics, or surface density, can lead to very different T cell responses (2024). Clearly, our understanding of antigen recognition would be aided by knowledge of the affinity and binding kinetics of the individual molecular interactions. Recent studies have provided affinity and kinetic data on the interactions of the TCR with peptide–MHC (25) and CD2 with its ligands CD48 (26) and CD58 (27, 28). In contrast, the interactions of CD28 and CTLA-4 with their ligands are less well characterized. Estimates have been made of the relative avidity and kinetics of CD28 and CTLA-4 binding to CD80 and CD86 (8, 29, 30), but no definitive affinity or kinetic data are available. A soluble CD80 Ig fusion protein was reported to bind to CD28 with a dissociation constant (Kd) of ∼200 nM (29) and to CTLA-4 with a Kd of ∼12 nM (8), but there was evidence that this CD80 Ig was not monomeric in solution (29). More recent kinetic studies have relied entirely on dimeric Ig fusion proteins (30, 31). Although potentially informative for comparative purposes, such studies do not provide accurate affinity and kinetic data of the sort that can be used to develop quantitative models of Ag recognition by T cells.

In the present study, we undertook to obtain precise estimates of the solution affinity and kinetic constants for the interaction between CD80 and both CD28 and CTLA-4. Molecules involved in cell–cell recognition can have very low affinities and fast dissociation rate constants, leading to technical problems in their measurement (32, 33). Recent studies (for reviews see 33, 34) have demonstrated that surface plasmon resonance (SPR)1, as implemented in the BIAcore instrument (35), is well suited to analysis of such interactions. We use SPR to show that CD80 binds CD28 and CTLA-4 with affinities considerably lower than previously reported, and with very fast kinetics.

Materials And Methods

Expression of CTLA-4 Ig.

The CTLA-4 Ig construct was very similar to that previously described (8) and was made by PCR, using as a template a cDNA library prepared from human peripheral blood acute lymphoblastic leukemia cells (Daenke, S., unpublished data). The 116 base 5′ primer CTAGCCACTGAAGCTTCACCAATGGGTGTACTGCTCACACAGAGGACGCTGCTCAGTCTGGTCCTTGCACTCCTGTTTCCAAGCATGGCGAGCATGGCAATGCACGTGGCCCAGCC encoded the oncostatin M leader (36) and 20 bases of CTLA-4 sequence and incorporated a HindIII restriction site. The encoded junction between the oncostatin leader (uppercase) and CTLA-4 (lowercase) was as follows: SMASMamhva. The 3′ primer ACGGATCCTTATCAGAATCTGGGCACGGTTC encoded the CTLA-4 sequence immediately upstream of the transmembrane region followed by a splice donor site and a BamHI restriction site. The amplified product was subcloned into the pIg expression vector (37) using its BamHI and HindIII restriction sites. pIg incorporates, downstream of the cloning site, a genomic sequence encoding the constant region of human IgG γ1 heavy chain. After splicing, the encoded junction between CTLA-4 (uppercase) and the γ1 heavy chain (lowercase) would be as follows: CPDSDepsksc. The sequence was confirmed by dideoxy sequencing. Stable high level expression of CTLA-4 Ig in Chinese hamster ovary (CHO)– K1 cells was achieved by calcium phosphate cotransfection of the CTLA-4 Ig encoding plasmid together with the glutamine synthetase–encoding expression vector pEE14, as previously described (3840). Clones expressing high levels of CTLA-4 Ig (∼30–40 mg/L) were identified by inhibition ELISA using a mAb specific for human IgG (40) and grown up to confluence in bulk culture before switching to serum-free medium supplemented with 2 mM Na butyrate. CTLA-4 Ig was then purified by affinity chromatography on protein A–sepharose (Pharmacia Biotech AB, Uppsala, Sweden) followed by size-exclusion chromatography on a SUPERDEX S200 HR10/30 column (Pharmacia Biotech).

Expression and Analysis of sCD80.

The soluble CD80 construct was designed to encode the extracellular portion of CD80 up to lysine-209 followed by a carboxy-terminal oligo-histidine tag for purification (sCD80his). It was made by PCR using cDNA from MT-2 cells (HTLV-1-transformed human T cells) as template. The 5′ primer TAGTAGAAGCTTTCCCCATCCGCTCAAGCAGGCCACCATGGGCCACACACGGAGG was complementary to the CD80 leader sequence but added an HindIII site and inserted, immediately upstream of the initiation codon, the 25 bases that precede the rat CD4 initiation codon (41). The 3′ primer TAGTAGTCTAGACTAATGATGATGATGATGATGCTTGGCTGTATTCCAGTTGAAGGT added six histidine residues and a stop codon after lysine 209, mutated threonine 208 to alanine to remove a potential NH2-linked glycosylation site, and added a XbaI site. The 10 carboxy-terminal amino acids of sCD80his were thus NTAKHHHHHH. The resulting PCR fragment was subcloned into the glutamine synthetase expression vector pEE14 (39) using its XbaI and HindIII restriction sites, and the sequence was confirmed by dideoxy sequencing. CHO-K1 cells were transfected as described (38, 39) with the sCD80hisencoding plasmid by calcium phosphate transfection. Clones expressing high levels of sCD80his (∼40 mg/L) were identified by growth in the presence of [35S]methionine/[35S]cysteine (TRANS35SLABEL; ICN Pharmaceuticals, Costa Mesa, CA), purification of labeled protein from the culture supernatant using Ni-NTA spin columns (Qiagen GmbH, Hilden, Federal Republic of Germany), and then SDS-PAGE of the protein followed by autoradiography. The best clone was grown up to confluence in bulk culture before switching to serum-free medium supplemented with 2 mM Na butyrate. sCD80his was purified by affinity chromatography using Ni-NTA resin (Qiagen GmbH) followed by size-exclusion chromatography on a SUPERDEX S200 HR10/30 column. The extinction coefficient (at 280 nm) of sCD80his was determined by amino acid analysis to be 1.41 ml.mg−1. The carboxy-terminal his tag was cleaved off by incubating 2.5 mg of sCD80his in 1.5 ml Tris–saline buffer (140 mM NaCl, 10 mM Tris [pH 7.5]) with 1.2 U of carboxypeptidase A conjugated to agarose beads (Sigma Chemical, Poole, UK) for 16 h at 30°C with agitation. Amino acid analysis confirmed that ⩾90% of the carboxy-terminal histidine residues (5.4 molecules per sCD80his molecule), but no other amino acids, were released during this incubation (data not shown). The carboxypeptidase A was removed by centrifugation and the digested sCD80his (sCD80) was repurified on a SUPERDEX S200 HR10/30 column (Fig. 1 C).

The proportion of sCD80 that possessed ligand binding activity was determined as follows. Protein A–sepharose beads (100 μl) were incubated with 0.4 mg of CTLA-4 Ig or (as a control) CD22 (d1-3) Ig (42) in 0.33 ml Tris–saline for 1 h at 4°C with rotation and then washed three times with 1.5 ml Tris–saline. CTLA-4 Ig or CD22 Ig beads (40 μl) were then added to 20 μl sCD80 (0.65 μg/μl in Tris–saline) and incubated for 4 h at 4°C with rotation. The beads were then pelleted and 10 μl of each supernant analyzed by SDS-PAGE, together with 3.3 μl of sCD80 that had not been exposed to beads (Fig. 1 B).

SPR Experiments.

Binding experiments were performed by SPR on a BIAcore instrument (35) upgraded with the BIAcore Upgrade Kit (BIAcore AB, St Albans, UK). All experiments were performed at 37°C (except where otherwise indicated) using HBSS buffer (25 mM Hepes [pH 7.4], 150 mM NaCl, 3.4 mM EDTA, and 0.005% surfactant P20) supplied by BIAcore. CTLA-4 Ig and CD28 Ig were covalently coupled by primary amine groups to the carboxymethylated dextran matrix on a research grade CM5 sensor chip (BIAcore) using the Amine Coupling Kit (BIAcore) as directed (43), with the following modifications. After an activation step of 15–240 s, CTLA-4 Ig (30 μg/ml in 10 mM Na acetate [pH 4.7]) or CD28 Ig (15 μg/ml in 10 mM Na acetate [pH 5]) were injected for 7 min. After coupling, CTLA-4 Ig and CD28 Ig were washed with a 3 min injection of NaOH (5 mM). NaOH (5 mM) was also used to regenerate immobilized CD28 Ig and CTLA-4 Ig. The anti-human IgG1 mAb R10Z8E9 was used as previously described (44) to immobilize CD28 Ig and CTLA-4 Ig indirectly to the sensor surface via their Ig fragment.

Analysis of Affinity and Kinetic Data.

Equilibrium binding analysis and analysis of the washout or dissociation phase was performed as previously described (27). Analysis of the injection or association phase was performed using the BIAevaluation software Version 2.1 (BIAcore). The kon was determined by nonlinear curve fitting of the following equation to the injection phase.

(1)

\begin{equation*}R(t)=R_{eq}{\cdot}(1-e^{-(k_{on}{\cdot}C+k_{off}){\cdot}t})\end{equation*}

where R(t) is the response (in response units) at time t, Req is the response at equilibrium, and C is the concentration of injected sCD80. The koff value used for this fit was obtained by analysis of the washout phase of the same injection. For the CTLA-4–sCD80 interaction, the kon was also estimated using an approach relying entirely on analysis of the injection phase, as described by Karrlson et al. (43). After injection at several different sCD80 concentrations, plots of dR/dt versus R for each concentration (C) give straight lines with a slope −ks where

(2)

\begin{equation*}k_{s}=k_{on}\hspace{.5em}\hspace{.5em}C+\hspace{.5em}k_{off}\end{equation*}

Values for kon and koff were obtained by a linear fit of a plot of ks versus C (see Fig. 4 E).

Results And Discussion

Expression and Characterization of Monomeric sCD80.

A soluble form of CD80 with a carboxy-terminal oligo-his tag (sCD80his) was expressed in CHO-K1 cells. Preliminary experiments indicated that the oligo-histidine tag predisposed towards the formation of multimeric aggregates (van der Merwe, P.A., and S.J. Davis, unpublished data) and so it was removed by digestion with carboxypeptidase A (see Materials and Methods) to yield sCD80. Analysis of sCD80 by reducing SDS-PAGE indicated that it migrated as a broad band with a size range of Mr 35–45,000 (Fig. 1 A). This is consistent with the predicted size of the protein backbone (Mr 24,747) and variable glycosylation of the seven potential NH2-linked glycosylation sites. sCD80 migrated slightly faster (Mr 30–43,000) under nonreducing conditions, indicating that the protein does not form disulphide-linked multimers, and consistent with the existence of two predicted disulphide bonds (45).

For valid affinity and kinetic analysis, it is critical that the interaction under study is monovalent (32), because increasing the binding valency leads to dramatic (but unpredictable) increases in the strength and stability of an interaction. The use of the term affinity is usually restricted to descriptions of the binding strength of monovalent interactions, whereas avidity is used to describe the binding strength of multivalent interactions. In the present study, monovalency was ensured by using a monomeric form of CD80 (sCD80). To check that sCD80 was indeed monomeric in solution, it was analyzed by size-exclusion chromatography (Fig. 1,C). sCD80 eluted at Mr ∼63,000 when using globular unglycosylated proteins to calibrate the column (Fig. 1,C). Although this is slightly higher than might be expected, sCD80 is heavily glycosylated and probably asymmetric. Therefore, we compared sCD80 with two similarly asymmetric glycosylated proteins, namely soluble rat CD2 (sCD2, Mr 26–34,000 on SDS-PAGE [46]) and soluble rat CD48–CD4 (sCD48–CD4, Mr 43–64,000 on SDS-PAGE [26, 47]), both of which are monomeric (26, 47). sCD80 eluted after sCD48–CD4 and ahead of sCD2 (Fig. 1 C), consistent with it existing as a monomer in solution.

sCD80 appeared to be folded correctly as it bound to all four mAbs tested (Table 1) and also bound both CD28 and CTLA-4 (see below). Accurate estimation of affinity and kinetic constants requires knowledge of the exact concentration of the soluble ligand, which in turn requires that the proportion of sCD80 that retains ligand binding activity is known. All of the sCD80 could not be assumed to be active because it had been purified using its oligo-histidine tag, and this would not discriminate between correctly and incorrectly folded forms of sCD80. The activity of sCD80 therefore was estimated directly by depleting the sCD80 with protein A–sepharose beads coated with CTLA-4 Ig (Fig. 1,B). CTLA-4 Ig beads were able to deplete all the sCD80 (Fig. 1 B), whereas CD22 Ig beads did not deplete, indicating that close to 100% of the sCD80 retains CTLA4-binding activity.

Expression and Analysis of CD28 Ig and CTLA-4 Ig.

The recombinant CD28 used in the present study (CD28 Ig) was a homodimeric fusion protein incorporating the Fc portion of human γ1 Ig heavy chain (29). We expressed and purified a similar CTLA-4 Ig fusion protein (see Materials and Methods). SDS-PAGE under reducing and nonreducing conditions indicated that CTLA-4 Ig was expressed as a disulphide-linked dimer (Fig. 1,A). For kinetic and affinity studies, CTLA-4 Ig and CD28 Ig were immobilized to a dextran matrix on the sensor surface either indirectly, via a mAb specific for human IgG1, or by direct covalent coupling through primary amines (see Materials and Methods). CD28 and CTLA-4 mAbs (Table 1) bound to both directly and indirectly coupled forms of CD28 Ig and CTLA-4 Ig (data not shown). Furthermore, sCD80 bound with a similar affinity to both directly and indirectly coupled CD28 Ig and CTLA-4 Ig (see below; Table 2), indicating that direct covalent coupling did not substantially disrupt the native structure of these proteins. All subsequent measurements were made using directly coupled CD28 Ig and CTLA-4 Ig.

Affinity Measurements.

Affinity and kinetic measurements were performed at 37°C except where otherwise indicated. The affinity of sCD80 binding to CTLA-4 and CD28 was measured directly by equilibrium binding analysis (Figs. 2 and 3), because this avoids the many potential pitfalls associated with kinetic measurements (see below; 48–50). Increasing concentrations of sCD80 were injected over sensor surfaces to which CTLA-4 Ig or CD28 Ig had been immobilized (Figs. 2,A and 3,A, respectively). It is noteworthy that at all sCD80 concentrations binding reached equilibrium very rapidly (95% binding within 20 s; faster for CD28) and that, in the washout phase after the injection, bound sCD80 dissociated within 20 s (faster for CD28). These features are typical of interactions with very fast binding kinetics. The sCD80 samples were also injected over a control sensor surface (with no protein immobilized) to measure the background response (Figs. 2,A and 3,A, right). Larger background responses are seen in Fig. 3,A because a tenfold higher range of sCD80 concentrations was injected over CD28 Ig (Figs. 2 and 3, legends). For each sCD80 concentration the binding response (measured in arbitrary response units [RU]) at equilibrium was calculated by subtracting the response seen in the control flow cell from the response seen in the CTLA-4 (see Fig. 2,B) or CD28 (Fig. 3,B) flow cells. A plot of the binding response indicates saturable binding and direct fitting of a standard Langmuir binding isotherm to the data gave Kd values of 0.38 and 4.2 μM for sCD80 binding to CTLA-4 and CD28, respectively (Figs. 2,B and 3,B, left). Scatchard plots of the data gave very similar Kd values (Figs. 2,B and 3,B, right). The mean Kd (± SD) values from several independent determinations are shown in Table 2.

Kinetic Measurements.

Measurements of binding kinetics are prone to error, particularly when the kinetics are very fast, as in the present study (4850). One source of error is that part of the response is a background signal that does not represent true binding. To correct for this, the response obtained when sCD80 was injected through a control flow cell (containing no immobilized protein) was subtracted before analysis. Figs. 4,A and 5,A show typical responses obtained after injection of sCD80 through flow cells with two different levels of CTLA-4 Ig (or CD28 Ig) immobilized, as well as through a control flow cell. Subtraction of the control flow cell response from the responses in the CD28 and CTLA-4 flow cells gives the actual binding response shown in Figs. 4,B and 5,B (solid lines), which was subjected to kinetic analysis. A second potential source of error is that binding and dissociation are limited by the rate at which protein is delivered to and removed from the sensor surface. This was addressed by using higher than normal flow rates (40 or 80 μl/min). These flow rates were judged to be optimal because halving them had little effect on the association (injection) or dissociation (washout) phases when sCD80 was injected over CTLA-4 (see Figs. 4,B and C) or CD28 (Figs. 5, B and C). It should be noted that even at very high flow rates, binding may still be limited by mass-transport within an unstirred layer close to the binding surface (48, 50). The effects of mass-transport limitations within this unstirred layer can be reduced by decreasing the level of immobilized ligand (see below). A third source of error is rebinding of protein during the dissociation (washout) phase, which will lead to underestimation of the dissociation rate. Rebinding can be decreased by immobilizing lower levels of ligand. This is illustrated in Figs. 4,C and 5,C, in which sCD80 dissociates more rapidly when the level of immobilized CTLA-4 or CD28 is decreased. sCD80 dissociated from sensor surfaces with high and low levels of CTLA-4 with apparent dissociation rate constants (koff) of 0.24 s−1 and 0.43 s−1, respectively (see Fig. 4,C; Table 3). Similarly, sCD80 dissociated from high and low levels of CD28 with koff values of 1.1 s−1 and 1.6 s−1, respectively (Fig. 5,C; Table 3). Although it is quite likely that some sCD80 rebinding is still occurring even at these lower CD28 Ig and CTLA-4 Ig levels, it proved difficult to collect data of satisfactory quality when CD28 Ig and CTLA-4 Ig levels were reduced further. Therefore, we assume that the actual koff values for dissociation of sCD80 from CTLA-4 and CD28 are at least 0.43 s−1 and 1.6 s−1, respectively.

Association rate constants (kon) for binding were estimated by nonlinear curve fitting to data from the injection phase (Figs. 4,D and 5,D) using koff values obtained from analysis of the corresponding dissociation phase. Reasonably good fits were obtained with a simple one-to-one (Langmuir) binding model (Eq. 1). When CTLA-4 and CD28 were immobilized at the lower levels, sCD80 bound with mean kon values of 9.4 × 105 M−1s−1 and 6.6 × 105 M−1s−1, respectively (Table 3). Slighty slower kon values were obtained with higher levels of immobilized CTLA-4 (6.2 × 105 M−1s−1) and CD28 (4.7 × 105 M−1s−1) (Table 3). As discussed above, this is likely to reflect underlying masstransport limitations within the unstirred layer, which would be noticeable at higher levels of immobilized ligand (49, 50). Because it was not possible to eliminate completely the effect of mass transport limitations, we assume that the actual kon values for sCD80 binding to CTLA-4 and CD28 are at least 9.4 × 105 M−1s−1 and 6.6 × 105 M−1s−1, respectively.

Kinetic constants for CTLA-4 binding were also estimated independently of the dissociation phase by analyzing the association phase after injection of different concentrations of sCD80 (see Materials and Methods [43]). Although less accurate and less stringent than a direct fit of equation 1 (48), this approach is useful for verification since it does not require prior measurement of the koff, but instead provides its own independent estimate (see Fig. 4,E). Such an analysis was not possible for the lower affinity CD80–CD28 interaction because it has faster kinetics (compare Figs. 4,D and 5,D) and requires much higher sample concentrations. The kon (3.2 × 105 M−1s−1) and koff (0.2 s−1) values measured in this manner for sCD80 binding to CTLA-4 Ig were only slightly slower than values obtained by the direct nonlinear curve fitting with similar levels of CTLA-4 (see Table 2).

The accuracy of the measured rate constants can be further assessed by comparing the ratio between the koff and the kon (which provides a calculated Kd or Kdcalc) with the Kd measured directly by equilibrium binding (Tables 2 and 3). For both CTLA-4 and CD28, the Kd and Kdcalc were very similar (Tables 2 and 3), indicating consistency between the kinetic and equilibrium binding analyses. However, this internal consistency does not exclude the possibility that the true kon and koff values are both faster than the measured values. Therefore, the measured kon and koff values represent lower limits for the true kon and koff.

Comparisons with Other Studies.

The affinities measured in the present study for CD80 binding CD28 (Kd 4 μM) and CTLA-4 (Kd 0.42 μM) are much lower than previously reported (8, 29). One possible difference is that these earlier measurements were made at 23°C (8, 29). However, we found that decreasing the temperature from 37°C to 25°C increased the affinity less than twofold (Table 2). A more significant difference is likely to be that the soluble CD80 Ig used in the earlier studies was not monomeric. This is supported by the observation that the CD80 Ig fusion protein used in these earlier studies, although monomeric on SDS-PAGE (Mr 70,000), eluted at Mr ∼350,000 by size-exclusion chromatography (29), suggesting the presence of higher aggregates. Such aggregates could well account for the much higher affinities previously reported. However, this explanation does not account for 100- to 200-fold higher avidity observed for soluble CTLA-4 Ig compared with soluble CD28 Ig (for example see reference 30), a difference much larger than the 10-fold difference in affinity reported in the present study. This discrepancy is not due to differences in the recombinant proteins used in these studies, because we were able to reproduce the large difference in avidity by injecting CD28 Ig and CTLA4 Ig over a sensor surface onto which sCD80 had been immobilized (Fig. 6). CTLA-4 Ig injected at 0.1 and 1 μg/ml bound to higher levels than 100-fold higher concentrations of CD28 Ig (Fig. 6), indicating a >100-fold higher avidity. Although it is unclear why the avidity difference between CTLA-4 Ig and CD28 Ig is so much greater than the affinity difference, these results illustrate a major disadvantage of using multimeric proteins for comparative binding studies.

A similar affinity constant for the CTLA-4–CD80 interaction (Kd 0.21 μM at 25°C) has recently been obtained by SPR using a monomeric form of CTLA-4 (51) in solution and a CD80 Ig fusion protein (29) covalently immobilized onto the sensor surface (52). No monomeric form of CD28 was analyzed by Greene et al. (52) but, unexpectedly, an apparently dimeric form of CD28 (CD28tp) bound the immobilized CD80 Ig with an avidity (Kd 2.1–41 μM at 25°C) similar to the affinity that we obtained for monomeric sCD80 binding to immobilized CD28 (Kd 2.5 μM at 25°C). CD28tp also bound immobilized CD80 Ig with an unusually slow apparent kon (7,000 M−1s−1). One explanation for this discrepency, which is consistent with the slow apparent kon, is that only a small proportion of the CD28tp was active. An alternative explanation is that covalent immobilization of the CD80 Ig alters preferentially its interaction with CD28 but not CTLA-4.

Functional Implications.

To understand the functional implications of the solution affinity and kinetic constants reported in the present study, it is necessary to extrapolate these values to interactions between the membrane-tethered forms of these molecules (28, 53). Like CD28, CD2 binds its ligand CD58 in solution with a very low affinity and rapid binding kinetics (27). Dustin et al. (28) have shown that the interaction between membrane-tethered CD2 and CD58 also exhibits rapid binding kinetics. This suggests that the fast solution-binding kinetics observed between these molecules is a reflection of rapid binding kinetics when they are attached to membrane. Theoretical considerations (53) suggest that the difference in the affinity of soluble CD80 for CD28 versus CTLA-4 is likely to be conserved for membrane-attached forms of these molecules. If correct, this implies that CTLA-4 will engage ∼10-fold lower surface densities of CD80 than CD28 because of its ∼10 fold higher affinity. Unlike CD28, CTLA-4 is not expressed on resting T cells (4) and, although expression is induced on T cell activation, CTLA-4 is always present at a ∼30- to 50-fold lower surface density than CD28 (54). Under these circumstances CTLA-4 is unlikely to compete effectively for CD80 and displace it from CD28, despite its higher affinity. Instead, both CD28 and CTLA-4 are likely to engage CD80 when they are expressed simultaneously. In this regard, it is noteworthy that inhibitory signals transmitted through CTLA-4 appear to be dominant over the activation signals transmitted through CD28 (55, 56).

The affinity constants reported in the present study and previous studies of CD2 and CD4 suggest that accessory T cell molecules, including those with signaling functions, have affinities comparable to or lower than the reported affinities of TCRs for their specific peptide–MHC ligands (Table 4). Even more striking are the 10- to 100-fold faster koff values seen for the CD2–CD58 and CD28–CD80 interactions compared with TCR/peptide–MHC interactions (Table 4). While it is possible that future studies will identify TCR/ peptide–MHC interactions with similarly fast koff values, these results suggest that the accessory molecule interactions are generally more unstable than TCR interactions. Indeed, the binding of CD4 and CD8 to MHC class II and MHC class I is likely to stabilize further TCR/peptide– MHC complexes relative to accessory molecule interactions (57).

These observations suggest that within the contact area between T cells and APC or target cells (18, 58), TCR/ peptide–MHC complexes will generally be longer lived than CD28–CD80 or CD2–CD58 complexes. This raises the question as to whether the rapid binding kinetics of CD2 and CD28 interactions are functionally significant. One crucial feature of T cell antigen recognition is the capacity of T cells to detect as few as 10 specific peptide–MHC ligands on cells (5961). Furthermore, Valitutti et al. (62) recently reported that, even when presented with very low levels of peptide–MHC (∼100 complexes per cell), a substantial proportion of TCRs on the T cell surface (∼18,000) appeared to be ligated in the process of T cell activation. Two important implications of these results are the following: (a) many peptide–MHC molecules will need to diffuse through the zone of contact between a T cell and an APC for the TCR to encounter specific peptide–MHC molecules; and (b) each specific peptide–MHC molecule will need to engage serially many TCRs (62). In turn, this implies that peptide–MHC and TCR molecules will need to diffuse rapidly into and out of a stable zone of contact between the T cells and APC and/or that new contacts will continually need to be formed between these cells (63). It seems likely that the very fast binding kinetics of CD2 and CD28 interactions will facilitate these processes by contributing to a highly dynamic contact zone between T cells and APC.

Since CD28 and CTLA-4 are clearly signaling molecules, able, like the TCR, to transmit positive and negative cells to T cells, the very fast koff values reported in the present study indicate that signaling between cells can be transmitted by very transient molecular interactions. Because in the case of the TCR, the nature of the signal (positive or negative) appears to be highly dependent on the kinetics of its interaction (22), it is possible that signaling through CD28 and CTLA-4 will be similarly sensitive to binding kinetics. Preliminary data suggest that CTLA-4 binds CD86 with a lower affinity and faster dissociation rate constant than CD80 (52), which may contribute to the reported functional differences between CD80 and CD86 (6).

In this study, we show that CD28 and CTLA-4 bind CD80 with far lower affinities than previously reported and that these low affinities are the result of very fast dissociation rate constants. These kinetic parameters are similar to those measured for CD2–ligand interactions but very different to reported values for TCR–ligand interactions. We propose that the fast binding kinetics of CD28 (and CD2) serve to optimize T cell antigen recognition by (a) allowing rapid formation and disruption of contacts between T cells and APC and (b) facilitating lateral diffusion of TCRs and peptide–MHC molecules through T cell–APC contact zones.

References

References
1
Hansen
JA
,
Martin
PJ
,
Nowinski
RC
Monoclonal antibodies identifying a novel T-cell antigen and Ia antigen of human lymphocytes
Immunogenetics
1980
10
247
260
2
Aruffo
A
,
Seed
B
Molecular cloning of a CD28 cDNA by a high-efficiency COS cell expression system
Proc Natl Acad Sci USA
1987
84
8573
8577
[PubMed]
3
Brunet
JF
,
Denizot
F
,
Luciani
MF
,
Roux-Dosseto
M
,
Suzan
M
,
Mattei
MG
,
Golstein
P
A new member of the immunoglobulin superfamily-CTLA-4
Nature (Lond)
1987
328
267
270
[PubMed]
4
Linsley
PS
,
Ledbetter
JA
The role of the CD28 receptor during T cell responses to antigen
Annu Rev Immunol
1993
11
191
211
[PubMed]
5
June
CH
,
Bluestone
JA
,
Nadler
LM
,
Thompson
CB
The B7 and CD28 receptor families
Immunol Today
1994
15
321
331
[PubMed]
6
Lenschow
DJ
,
Walunas
TL
,
Bluestone
JA
CD28/B7 system of T cell costimulation
Annu Rev Immunol
1996
14
233
258
[PubMed]
7
Linsley
PS
,
Clark
EA
,
Ledbetter
JA
T-cell antigen CD28 mediates adhesion with B cells by interacting with activation antigen B7/BB-1
Proc Natl Acad Sci USA
1990
87
5031
5035
[PubMed]
8
Linsley
PS
,
Brady
W
,
Urnes
M
,
Grosmaire
LS
,
Damle
NK
,
Ledbetter
JA
CTLA-4 is a second receptor for the B cell activation antigen B7
J Exp Med
1991
174
561
569
[PubMed]
9
Azumo
M
,
Ito
D
,
Yagita
H
,
Okumura
K
,
Phillips
JH
,
Lanier
LL
,
Somoza
C
B70 antigen is a second ligand for CTLA-4 and CD28
Nature (Lond)
1993
366
76
79
[PubMed]
10
Freeman
GJ
,
Gribben
JG
,
Boussiotis
VA
,
Ng
JW
,
Restivo
VA
,
Jr
,
Lombard
LA
,
Gray
GS
,
Nadler
LM
Cloning of B7-2: a CTLA-4 counter-receptor that costimulates human T cell proliferation
Science (Wash DC)
1993
262
909
911
[PubMed]
11
Freeman
GJ
,
Borriello
F
,
Hodes
RJ
,
Reiser
H
,
Hathcock
KS
,
Laszlo
G
,
McKnight
AJ
,
Kim
J
,
Du
L
,
Lombard
DB
et al
Uncovering of functional alternative CTLA-4 counter-receptor in B7-deficient mice
Science (Wash DC)
1993
262
907
909
[PubMed]
12
Hathcock
KS
,
Laszlo
G
,
Dickler
HB
,
Bradshaw
J
,
Linsley
P
,
Hodes
RJ
Identification of an alternative CTLA-4 ligand costimulatory for T cell activation
Science (Wash DC)
1993
262
905
907
[PubMed]
13
Linsley
PS
Distinct roles for CD28 and cytotoxic T lymphocyte–associated molecule-4 receptors during T cell activation?
J Exp Med
1995
182
289
292
[PubMed]
14
Kearney
ER
,
Walunas
TL
,
Karr
RW
,
Morton
PA
,
Loh
DY
,
Bluestone
JA
,
Jenkins
MK
Antigendependent clonal expansion of a trace population of antigen-specific CD4+ T cells in vivo is dependent on CD28 costimulation and inhibited by CTLA-4
J Immunol
1995
155
1032
1036
[PubMed]
15
Tivol
EA
,
Borriello
F
,
Schweitzer
AN
,
Lynch
WP
,
Bluestone
JA
,
Sharpe
AH
Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4
Immunity
1995
3
541
547
[PubMed]
16
Waterhouse
P
,
Penninger
JM
,
Timms
E
,
Wakeham
A
,
Shahinian
A
,
Lee
KP
,
Thompson
CB
,
Griesser
H
,
Mak
TW
Lymphoproliferative disorders with early lethality in mice deficient in CTLA-4
Science (Wash DC)
1995
270
985
988
[PubMed]
17
Marengére
LEM
,
Waterhouse
HW
,
Duncan
GS
,
Mittrücker
HW
,
Feng
GS
,
Mak
TW
Regulation of T cell receptor signalling by tyrosine phosphatase SYP association with CTLA-4
Science (Wash DC)
1996
272
1170
1173
[PubMed]
18
Springer
TA
Adhesion receptors of the immune system
Nature (Lond)
1990
346
425
434
[PubMed]
19
Clark
EA
,
Ledbetter
JA
How T and B cells talk to each other
Nature (Lond)
1994
367
425
428
[PubMed]
20
Jameson
SC
,
Bevan
MJ
T cell receptor antagonists and partial agonists
Immunity
1995
2
1
11
[PubMed]
21
Sykulev
Y
,
Cohen
RJ
,
Eisen
HN
The law of mass action governs antigen-stimulated cytolytic activity of CD8+ cytotoxic T lymphocytes
Proc Natl Acad Sci USA
1995
92
11990
11992
[PubMed]
22
Alam
SM
,
Travers
PJ
,
Wung
JL
,
Nasholds
W
,
Redpath
S
,
Jameson
SC
,
Gascoigne
NRJ
T-cell-receptor affinity and thymocyte positive selection
Nature (Lond)
1996
381
616
620
[PubMed]
23
Valitutti
S
,
Müller
S
,
Dessing
M
,
Lanzavecchia
A
Different responses are elicited in cytotoxic T lymphocytes by different levels of T cell receptor occupancy
J Exp Med
1996
183
1917
1921
[PubMed]
24
Viola
A
,
Lanzavecchia
A
T cell activation determined by T cell receptor number and tunable thresholds
Science (Wash DC)
1996
273
104
106
[PubMed]
25
Fremont
DH
,
Rees
WA
,
Kozono
H
Biophysical studies of T-cell receptors and their ligands
Curr Opin Immunol
1996
8
93
100
[PubMed]
26
van der Merwe
PA
,
Brown
MH
,
Davis
SJ
,
Barclay
AN
Affinity and kinetic analysis of the interaction of the cell-adhesion molecules rat CD2 and CD48
EMBO (Eur Mol Biol Organ) J
1993
12
4945
4954
[PubMed]
27
van der Merwe
PA
,
Barclay
AN
,
Mason
DW
,
Davies
EA
,
Morgan
BP
,
Tone
M
,
Krishnam
AKC
,
Ianelli
C
,
Davis
SJ
The human cell-adhesion molecule CD2 binds CD58 with a very low affinity and an extremely fast dissociation rate but does not bind CD48 or CD59
Biochemistry
1994
33
10149
10160
[PubMed]
28
Dustin
ML
,
Ferguson
LM
,
Chan
P
,
Springer
TA
,
Golan
DE
Visualization of the CD2 interaction with LFA-3 and determination of the two-dimensional dissociation constant for adhesion receptors in a contact area
J Cell Biol
1996
132
465
474
[PubMed]
29
Linsley
PS
,
Brady
W
,
Grosmaire
L
,
Aruffo
A
,
Damle
NK
,
Ledbetter
JA
Binding of the B cell activation antigen B7 to CD28 costimulates T cell proliferation and interleukin 2 mRNA accumulation
J Exp Med
1991
173
721
730
[PubMed]
30
Linsley
PS
,
Greene
JL
,
Brady
W
,
Bajorath
J
,
Ledbetter
JA
,
Peach
R
Human B7-1 (CD80) and B7-2 (CD86) bind with similar avidities but distinct kinetics to CD28 and CTLA-4 receptors
Immunity
1994
1
793
801
[PubMed]
31
Morton
PA
,
Fu
XT
,
Stewart
JA
,
Giacoletto
KS
,
White
SL
,
Leysath
CE
,
Evans
RJ
,
Shieh
JJ
,
Karr
RW
Differential effects of CTLA-4 substitutions on binding of human CD80 (B7-1) and CD86 (B7-2)
J Immunol
1996
156
1047
1054
[PubMed]
32
van der Merwe
PA
,
Barclay
AN
Transient intercellular adhesion: the importance of weak protein–protein interactions
Trends Biochem Sci
1994
19
354
358
[PubMed]
33
van der Merwe
PA
,
Barclay
AN
Analysis of cell adhesion molecule interactions using surface plasmon resonance
Curr Opin Immunol
1996
8
257
261
[PubMed]
34
Margulies
DH
,
Plaksin
D
,
Khilko
SN
,
Jelonek
MT
Studying interactions involving the T-cell antigen receptor by surface plasmon resonance
Curr Opin Immunol
1996
8
262
270
[PubMed]
35
Jönsson
U
,
Fägerstam
L
,
Ivarsson
B
,
Johnsson
B
,
Karlsson
R
,
Lundh
K
,
Löfås
S
,
Persson
B
,
Roos
H
,
Rönnberg
I
et al
Real-time biospecific interaction analysis using surface plasmon resonance and sensor chip technology
BioTechniques
1991
11
620
627
[PubMed]
36
Malik
N
,
Kallestad
JC
,
Gunderson
NL
,
Austin
SD
,
Neubauer
MG
,
Ochs
V
,
Marquardt
H
,
Zarling
JM
,
Shoyab
M
,
Wei
C
et al
Molecular cloning, sequence analysis, and functional expression of a novel growth regulator, oncostatin M
Mol Cell Biol
1989
9
2847
2853
[PubMed]
37
Simmons, D.L. 1993. Cloning cell surface molecules by transient expression in mammalian cells. In Cellular interactions in development: a practical approach. D.A. Hartley, editor. Oxford, Oxford University Press. 93–127.
38
Davis
SJ
,
Ward
HA
,
Puklavec
MJ
,
Willis
AC
,
Williams
AF
,
Barclay
AN
High level expression in Chinese hamster ovary cells of soluble forms of CD4 T lymphocyte glycoprotein including glycosylation variants
J Biol Chem
1990
265
10410
10418
[PubMed]
39
Bebbington, C.R. 1991. Expression of antibody genes in nonlymphoid mammalian cells. Methods Enzymol. 2(Suppl): 136–145.
40
Brown
MH
,
Preston
S
,
Barclay
AN
A sensitive assay for detecting low affinity interactions at the cell surface reveals no additional ligands for the adhesion pair rat CD2 and CD48
Eur J Immunol
1995
25
3222
3228
[PubMed]
41
Clark
SJ
,
Jefferies
WA
,
Barclay
AN
,
Gagnon
J
,
Williams
AF
Peptide and nucleotide sequences of rat CD4 (W3/25) antigen: evidence for derivation from a structure with four immunoglobulin-related domains
Proc Natl Acad Sci USA
1987
84
1649
1653
[PubMed]
42
Kelm
S
,
Pelz
A
,
Schauer
R
,
Filbin
MT
,
Tang
S
,
de Bellard
M
,
Schnaar
RL
,
Mahoney
JA
,
Hartnell
A
,
Bradfield
P
,
Crocker
PR
Sialoadhesin, myelin-associated glycoprotein and CD22 define a new family of sialic acid–dependent adhesion molecules of the immunoglobulin superfamily
Curr Biol
1994
4
965
972
[PubMed]
43
Karlsson
R
,
Michaelsson
A
,
Mattsson
L
Kinetic analysis of monoclonal antibody–antigen interactions with a new biosensor based analytical system
J Immunol Methods
1991
145
229
240
[PubMed]
44
Nath
D
,
van der Merwe
PA
,
Kelm
S
,
Bradfield
P
,
Crocker
PR
The amino-terminal immunoglobulinlike domain of sialoadhesin contains the sialic acid binding site: comparison with CD22
J Biol Chem
1995
270
26184
26191
[PubMed]
45
Freeman
GJ
,
Freedman
AS
,
Segil
JM
,
Lee
G
,
Whitman
JF
,
Nadler
LM
B7, a new member of the Ig superfamily with unique expression on activated and neoplastic B cells
J Immunol
1989
143
2714
2722
[PubMed]
46
Gray
F
,
Cyster
JG
,
Willis
AC
,
Barclay
AN
,
Williams
AF
Structural analysis of the CD2 T lymphocyte antigen by site-directed mutagenesis to introduce a disulphide bond into domain 1
Prot Engin
1993
6
965
970
[PubMed]
47
Brown
MH
,
Barclay
AN
Expression of immunoglobulin and scavenger receptor superfamily domains as chimeric proteins with domains 3 and 4 of CD4 for ligand analysis
Prot Engin
1994
7
515
521
[PubMed]
48
O'Shannessy
DJ
Determination of kinetic rate and equilibrium binding constants for macromolecular interactions: a critique of the surface plasmon resonance literature
Curr Opin Biotechnol
1994
5
65
71
[PubMed]
49
Nieba
L
,
Krebber
A
,
Plückthun
A
Competition BIAcore for measuring true affinities: large differences in values determined from binding kinetics
Anal Biochem
1996
234
155
165
[PubMed]
50
Schuck
P
Kinetics of ligand-binding to receptor immobilized in a polymer matrix, as detected with an evanescent wave biosensor. 1. A computer simulation of the influence of mass-transport
Biophysical J
1996
70
1230
1249
[PubMed]
51
Linsley
PS
,
Nadler
SG
,
Bajorath
J
,
Peach
R
,
Leung
HT
,
Rogers
J
,
Bradshaw
J
,
Stebbins
M
,
Leytze
G
,
Brady
W
et al
Binding stoichiometry of cytotoxic T lymphocyte–associated molecule-4 (CTLA-4). A disulphidelinked homodimer binds two CD86 molecules
J Biol Chem
1995
270
15417
15424
[PubMed]
52
Greene
JL
,
Leytze
GM
,
Emswiler
J
,
Peach
R
,
Bajorath
J
,
Cosand
W
,
Linsley
PS
Covalent dimerization of CD28/CTLA-4 and oligomerization of CD80/ CD86 regulate T cell costimulatory interactions
J Biol Chem
1996
271
26762
26771
[PubMed]
53
Bell
GI
Models for specific adhesion of cells to cells
Science (Wash DC)
1978
200
618
627
[PubMed]
54
Linsley
PS
,
Greene
JL
,
Tan
P
,
Bradshaw
J
,
Ledbetter
JA
,
Anasetti
C
,
Damle
NK
Coexpression and functional cooperation of CTLA-4 and CD28 on activated T lymphocytes
J Exp Med
1992
176
1595
1604
[PubMed]
55
Krummel
MF
,
Allison
JP
CD28 and CTLA-4 have opposing effects on the response of T cells to stimulation
J Exp Med
1995
182
459
465
[PubMed]
56
Walunas
TL
,
Bakker
CY
,
Bluestone
JA
CTLA-4 ligation blocks CD28-dependent T cell activation
J Exp Med
1996
183
2541
2550
[PubMed]
57
Luescher
IF
,
Vivier
E
,
Layer
A
,
Mahiou
J
,
Godeau
F
,
Malissen
B
,
Romero
P
CD8 modulation of T-cell antigen receptor–ligand interactions on living cytotoxic T lymphocytes
Nature (Lond)
1995
373
353
356
[PubMed]
58
Davis
SJ
,
van der Merwe
PA
Structure and ligand interactions of CD2: implications for T-cell function
Immunol Today
1996
17
177
187
[PubMed]
59
Demotz
S
,
Grey
HM
,
Sette
A
The minimal number of class II MHC–antigen complexes needed for T cell activation
Science (Wash DC)
1990
249
1028
1030
[PubMed]
60
Christinck
ER
,
Luscher
MA
,
Barber
BH
,
Williams
DB
Peptide binding to class I MHC on living cells and quantitation of complexes required for CTL lysis
Nature (Lond)
1991
352
67
70
[PubMed]
61
Kageyama
S
,
Tsomides
TJ
,
Sykulev
Y
,
Eisen
HN
Variation in the number of peptide–MHC class I complexes required to activate cytotoxic T cell responses
J Immunol
1995
154
567
576
[PubMed]
62
Valitutti
S
,
Müller
S
,
Cella
M
,
Padovan
E
,
Lanzavecchia
A
Serial triggering of many T-cell receptors by a few peptide–MHC complexes
Nature (Lond)
1995
375
148
151
[PubMed]
63
Valitutti
S
,
Dessing
M
,
Aktories
K
,
Gallati
H
,
Lanzavecchia
A
Sustained signalling leading to T cell activation results from prolonged T cell receptor occupancy. Role of the T cell actin cytoskeleton
J Exp Med
1995
181
577
584
[PubMed]
64
Ghiotto-Ragueneau
M
,
Battifora
M
,
Truneh
A
,
Waterfield
MD
,
Olive
D
Comparison of CD28–B7.1 and B7.2 functional interaction in resting human T cells: phosphatidylinositol 3-kinase association to CD28 and cytokine production
Eur J Immunol
1996
26
34
41
[PubMed]
65
Valle
A
,
Garrone
P
,
Bonnefoy
JY
,
Freedman
AS
,
Freeman
G
,
Nadler
LM
,
Banchereau
J
mAb 104, a new monoclonal antibody, recognizes the B7 antigen that is expressed on activated B cells and HTLV-1 transformed cells
Immunology
1990
69
531
535
[PubMed]
66
Schlossman, S.F., L. Boumsell, W. Gilks, J.M. Harlan, T. Kishimoto, C. Morimoto, J. Ritz, S. Shaw, R. Silverstein, T.A. Springer, T.F. Tedder, and R.F. Todd, editors. 1995. Leucocyte Typing V: White Cell Differentiation Antigens. Oxford, Oxford University Press.
67
Yokochi
T
,
Holly
RD
,
Clark
EA
B lymphoblast antigen (BB-1) expressed on Epstein–Barr virus–activated B cell blasts, B lymphoblastoid cell lines, and Burkitt's lymphoma
J Immunol
1982
128
823
827
[PubMed]
68
Nunés
J
,
Klasen
S
,
Ragueneau
M
,
Pavon
C
,
Couez
D
,
Mawas
C
,
Bagnasco
M
,
Olive
D
CD28 mAbs with distinct binding properties differ in their ability to induce T cell activation: analysis of early and late activation events
Int Immunol
1993
5
311
316
[PubMed]
69
Okubo
K
,
Hagiwara
S
,
Shiotsuki
K
,
Sagawa
K
,
Yokoyama
MM
A new monoclonal antibody (KOLT-2) specific to the cell surface antigen on activated human T lymphocytes
Acta Haematol Jpn
1984
47
1433
1444
[PubMed]
70
Matsui
K
,
Boniface
JJ
,
Reay
PA
,
Schild
H
,
Fazekas de St
B
,
Groth
,
Davis
MM
Low affinity interaction of peptide-MHC complexes with T cell receptors
Science (Wash DC)
1991
254
1788
1791
[PubMed]
71
Matsui
K
,
Boniface
JJ
,
Steffner
P
,
Reay
PA
,
Davis
MM
Kinetics of T-cell receptor binding to peptide/I-Ek complexes: correlation of the dissociation rate with T-cell responsiveness
Proc Natl Acad Sci USA
1994
91
12862
12866
[PubMed]
72
Sykulev
Y
,
Brunmark
A
,
Jackson
M
,
Cohen
RJ
,
Peterson
PA
,
Eisen
HN
Kinetics and affinity of reactions between an antigen-specific T cell receptor and peptide–MHC complexes
Immunity
1994
1
15
22
[PubMed]
73
Corr
M
,
Slanetz
AE
,
Boyd
LF
,
Jelonek
MT
,
Khilko
S
,
Al-Ramadi
BK
,
Kim
YS
,
Maher
SE
,
Bothwell
ALM
,
Margulies
DH
T cell receptor–MHC class I peptide interactions: affinity, kinetics, and specificity
Science (Wash DC)
1994
265
946
949
[PubMed]
74
Cammarota
G
,
Scheirle
A
,
Takacs
B
,
Doran
DM
,
Knorr
R
,
Bannwarth
W
,
Guardiola
J
,
Sinigaglia
F
Identification of the CD4 binding site on the β2 domain of HLA-DR molecules
Nature (Lond)
1992
356
799
801
[PubMed]
75
Weber
S
,
Karjalainen
K
Mouse CD4 binds MHC class II with extremely low affinity
Int Immunol
1993
5
695
698
[PubMed]

We gratefully acknowledge Neil Barclay, Marion Brown, and Don Mason for providing valuable advice and critically reading this manuscript; Liz Davies for constructing the sCD80his-encoding plasmid; Marion Brown and Fabiana Horn for expression and purification of CTLA-4 Ig; and Tony Willis for performing the amino acid analyses. We thank Drs. D. Olive, R.A.W. van Lier, and K. Sagawa for kindly providing us with monoclonal antibodies listed in Table 1.

This work was supported by the United Kingdom Medical Research Council and the Wellcome Trust. D.L. Bodian was supported by the Cancer Research Fund of the Damon Runyon–Walter Winchell Foundation, Fellowship DRG-1246.

1Abbreviations used in this paper: CHO, Chinese hamster ovary; FC, flow cell; koff, dissociation rate constant; kon, association rate constant; RU, response unit; sCD80his, soluble CD80 with carboxy-terminal oligo-histidine tag; SPR, surface plasmon resonance.

Author notes

Address correspondence to P. Anton van der Merwe, MRC Cellular Immunology Unit, Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom.