Skip to Main Content
Article navigation
Introduction

RFX5 encodes regulatory factor X 5, a transcription factor essential for MHC class II gene expression and proper antigen presentation. Homozygous mutations cause Bare Lymphocyte Syndrome type II (BLS II), a form of combined immunodeficiency with variable clinical severity.

Case Presentation

We report a 50-year-old female patient presenting with a syndromic combined immunodeficiency. Since childhood, she exhibited recurrent respiratory tract infections, persistent mucocutaneous candidiasis, and severe viral infections, including herpesvirus reactivations. Clinical features included proportionate short stature, facial dysmorphism (flattened midface, hypertelorism), and mild developmental delay. Immunological workup revealed hypogammaglobulinemia with low switched memory B cells, CD4+ lymphopenia, with decreased effector CD4+ cells and absent DR expression, reduced antigen-specific proliferative responses. Over an eight-year follow-up period, the patient received intravenous immunoglobulin replacement therapy, experiencing a fair quality of life. She presented with recurrent respiratory infections necessitating multiple hospitalizations, with Aspergillus flavus, Aspergillus fumigatus, and Nocardia cyriacigeorgica isolated from cultures. She developed an invasive vulvar squamous cell carcinoma. Due to the extensive nature of the lesion, the surgery was planned in two stages. Surgical treatment was incomplete due to her physical condition. The patient died due to septic shock. Genetic testing identified a homozygous frameshift variant in RFX5: c.857_858+19delAGGTAAGGAAGTCAGTGGCCC (p.Gln286fs), predicted to disrupt DNA binding and abolish MHC class II expression.

Discussion

This case illustrates a severe form of RFX5-related combined immunodeficiency with syndromic features, opportunistic infections, and malignancy, likely reflecting profound antigen presentation impairment. The development of early-onset cancer underscores the broader oncogenic risk associated with chronic immune dysregulation in MHC class II deficiency.

Conclusion

Homozygous RFX5 mutations should be considered in patients with combined immunodeficiency and syndromic features. MHC class II expression testing remains critical in the diagnostic approach to such patients. Early genetic diagnosis is critical for anticipatory management and considering different therapeutic options.

This abstract is available under a Creative Commons License (Attribution 4.0 International, as described at https://creativecommons.org/licenses/by-nc-nd/4.0/).

or Create an Account

Close Modal
Close Modal