Skip to Main Content
Article navigation
Introduction

The SAMD9L gene regulates proteins involved in the cell cycle and DNA damage repair. Mutations in the SAMD9L protein have been associated with monosomy 7 in myelodysplastic syndrome, leukemia, ataxia-pancytopenia syndrome, and immunodeficiency.

Case Presentation

A 10-year-old female presented with anemia, neutropenia, and thrombocytopenia since 2 years and invasive infections (pneumonia) at 6 years. Her brother died at 18 months of age due to pancytopenia. Immunological assessment revealed hypogammaglobulinemia (IgG: 247 mg/dL), CD20+ lymphopenia (73 cells/mm3), decreased pre-switch memory B cells (2%), increased transitional B cells (12.5%), and reduced natural killer cells (24 cells/mm3). Bone marrow biopsy showed myelodysplastic changes and cytogenetic analysis identified monosomy 7 in 8 metaphases (45,XX,-7), for a total of 20 metaphases analyzed. Whole exome sequencing (WES) identified a heterozygous variant in the SAMD9L: c.4469A>C (p.Lys1490Thr), classified as a variant of uncertain significance (VUS). Additionally, two heterozygous VUS were identified in the TCN2 gene (c.940+delT and c.940+25delGCCCAACTTTTTGTGGAAGCAC), which were excluded due to normal vitamin B12, folic acid, and homocysteine levels. Sanger sequencing confirmed the presence of the SAMD9L variant in the patient’s mother; father and brother tested negative. Immunoglobulin replacement therapy was initiated with good evolution and she remained asymptomatic. At 9 years, cytopenias had resolved. Serial bone marrow examinations showed persistent monosomy 7, although with a reduced number of metaphase abnormalities in cytogenetic analyses (two metaphases with 45,XX,-7). She is currently a candidate for hematopoietic stem cell transplantation (HSCT).

Discussion

Mutations in SAMD9L can present with variable clinical expressivity; therefore, evaluation of family members is recommended. Somatic inactivating mutations in the bone marrow have been reported; however, there is currently no consensus regarding the use of HSCT in patients with mild phenotypes or spontaneous reversion of monosomy 7. Long-term monitoring of bone marrow abnormalities is essential to guide therapeutic decision-making.

This abstract is available under a Creative Commons License (Attribution 4.0 International, as described at https://creativecommons.org/licenses/by-nc-nd/4.0/).

or Create an Account

Close Modal
Close Modal