Article navigation
Introduction

The SAMD9L gene regulates proteins involved in the cell cycle and DNA damage repair. Mutations in the SAMD9L protein have been associated with monosomy 7 in myelodysplastic syndrome, leukemia, ataxia-pancytopenia syndrome, and immunodeficiency.

Case Presentation

A 10-year-old female presented with anemia, neutropenia, and thrombocytopenia since 2 years and invasive infections (pneumonia) at 6 years. Her brother died at 18 months of age due to pancytopenia. Immunological assessment revealed hypogammaglobulinemia (IgG: 247 mg/dL), CD20+ lymphopenia (73 cells/mm3), decreased pre-switch memory B cells (2%), increased transitional B cells (12.5%), and reduced natural killer cells (24 cells/mm3). Bone marrow biopsy showed myelodysplastic changes and cytogenetic analysis identified monosomy 7 in 8 metaphases (45,XX,-7), for a total of 20 metaphases analyzed. Whole exome sequencing (WES) identified a heterozygous variant in the SAMD9L: c.4469A>C (p.Lys1490Thr), classified as a variant of uncertain significance (VUS). Additionally, two heterozygous VUS were identified in the TCN2 gene (c.940+delT and c.940+25delGCCCAACTTTTTGTGGAAGCAC), which were excluded due to normal vitamin B12, folic acid, and homocysteine levels. Sanger sequencing confirmed the presence of the SAMD9L variant in the patient’s mother; father and brother tested negative. Immunoglobulin replacement therapy was initiated with good evolution and she remained asymptomatic. At 9 years, cytopenias had resolved. Serial bone marrow examinations showed persistent monosomy 7, although with a reduced number of metaphase abnormalities in cytogenetic analyses (two metaphases with 45,XX,-7). She is currently a candidate for hematopoietic stem cell transplantation (HSCT).

Discussion

Mutations in SAMD9L can present with variable clinical expressivity; therefore, evaluation of family members is recommended. Somatic inactivating mutations in the bone marrow have been reported; however, there is currently no consensus regarding the use of HSCT in patients with mild phenotypes or spontaneous reversion of monosomy 7. Long-term monitoring of bone marrow abnormalities is essential to guide therapeutic decision-making.

This abstract is available under a Creative Commons License (Attribution 4.0 International, as described at https://creativecommons.org/licenses/by-nc-nd/4.0/).

or Create an Account

Close Modal
Close Modal