Intestinal Cl− secretion is stimulated by cyclic AMP (cAMP) and intracellular calcium ([Ca2+]i). Recent studies show that protein kinase A (PKA) and the exchange protein directly activated by cAMP (Epac) are downstream targets of cAMP. Therefore, we tested whether both PKA and Epac are involved in forskolin (FSK)/cAMP-stimulated Cl− secretion. Human intestinal T84 cells and mouse small intestine were used for short circuit current (Isc) measurement in response to agonist-stimulated Cl− secretion. FSK-stimulated Cl− secretion was completely inhibited by the additive effects of the PKA inhibitor, H89 (1 µM), and the [Ca2+]i chelator, 1,2-bis-(o-aminophenoxy)-ethane-N,N,N’,N’-tetraacetic acid, tetraacetoxymethyl ester (BAPTA-AM; 25 µM). Both FSK and the Epac activator 8-pCPT-2’-O-Me-cAMP (50 µM) elevated [Ca2+]i, activated Ras-related protein 2, and induced Cl− secretion in intact or basolateral membrane–permeabilized T84 cells and mouse ileal sheets. The effects of 8-pCPT-2’-O-Me-cAMP were completely abolished by BAPTA-AM, but not by H89. In contrast, T84 cells with silenced Epac1 had a reduced Isc response to FSK, and this response was completely inhibited by H89, but not by the phospholipase C inhibitor U73122 or BAPTA-AM. The stimulatory effect of 8-pCPT-2’-O-Me-cAMP on Cl− secretion was not abolished by cystic fibrosis transmembrane conductance (CFTR) inhibitor 172 or glibenclamide, suggesting that CFTR channels are not involved. This was confirmed by lack of effect of 8-pCPT-2’-O-Me-cAMP on whole cell patch clamp recordings of CFTR currents in Chinese hamster ovary cells transiently expressing the human CFTR channel. Furthermore, biophysical characterization of the Epac1-dependent Cl− conductance of T84 cells mounted in Ussing chambers suggested that this conductance was hyperpolarization activated, inwardly rectifying, and displayed a Cl−>Br−>I− permeability sequence. These results led us to conclude that the Epac-Rap-PLC-[Ca2+]i signaling pathway is involved in cAMP-stimulated Cl− secretion, which is carried by a novel, previously undescribed Cl− channel.
INTRODUCTION
The CFTR is the major Cl− channel found in the apical membrane of intestinal and airway epithelial cells. PKA phosphorylates and opens CFTR (Barrett, 2000; Barrett and Keely, 2000; Huang et al., 2000). Therefore, most studies on intestinal and airway Cl− secretion have focused on PKA as the downstream target of cAMP. Two major intracellular cAMP receptors are now known to mediate cAMP effects in vivo: the classical cAMP-dependent PKA pathway and the recently discovered exchange protein directly activated by cAMP (Epac). Epac, upon binding of cAMP, activates PKA-independent signaling cascades via small G proteins (de Rooij et al., 1998; Kawasaki et al., 1998). Many cAMP-mediated physiological processes that were previously thought to be solely mediated by PKA have now been shown to be mediated in parallel by Epac (Bos, 2006). For instance, glucagon-like peptide 1 is a cAMP-elevating agent. It stimulates insulin secretion in pancreatic β cells via both PKA- and Epac-dependent pathways, and the latter involves Ca2+-dependent exocytosis of insulin granules and inhibition of ATP-sensitive K+ channels (KATP channels) (Holz, 2004; Kang et al., 2008).
Human intestinal T84 cells have been used as a model for studying the physiology and regulation of intestinal Cl− secretion (Dharmsathaphorn and Madara, 1990). The current model of Cl− secretion involves electroneutral Cl− entry across the basolateral membrane via the Na+/K+/2Cl− cotransporter, followed by electrogenic Cl− exit across the apical membrane via Cl− channels. Simultaneous activation of basolateral K+ channels maintains a favorable electrical gradient for apical Cl− efflux by limiting cell depolarization. Because Cl− carries a negative charge, the positively charged Na+ ion follows the negative charge gradient across the epithelial cell layer through cation-selective tight junctions. Water, which is driven by the osmotic gradient, follows the net transepithelial NaCl movement (Barrett, 2000; Fuller and Benos, 2000).
Cyclic nucleotides such as cAMP are major regulators of Cl− secretion in T84 cells. Forskolin (FSK), which acts on adenylate cyclase to elevate intracellular cAMP, and the cAMP analogue 8-Br-cAMP are commonly used to probe the mechanism of PKA-dependent stimulation of Cl− secretion. However, it appears that PKA may not be the only target of cAMP because intracellular calcium ([Ca2+]i) can be elevated in response to FSK and/or cAMP. For instance, Merlin et al. (1998) previously showed that FSK elevates [Ca2+]i by unknown mechanisms in T84 cells. Similarly, FSK/cAMP increases [Ca2+]i in chicken enterocytes (Semrad and Chang, 1987). These observations suggest that FSK elicits Cl− secretion by activating not only PKA, but also other signaling pathways such as [Ca2+]i. Furthermore, Epac has been shown to transduce cAMP into [Ca2+]i signaling via PLCε, and this effect of Epac is PKA independent (Schmidt et al., 2001). Because cAMP and [Ca2+]i are major regulators of intestinal Cl− secretion, we ask whether Epac plays a role in FSK- or cAMP-stimulated Cl− secretion in intestinal epithelial cells, and whether Epac links intracellular cAMP signaling to [Ca2+]i elevation, thus allowing cAMP to mediate Cl− secretion in a PKA-dependent and -independent manner. Furthermore, Cl− channels are a functionally and structurally diverse group, and some are involved in normal fluid transport across various epithelia (Kidd and Thorn, 2000; Hartzell et al., 2005; Verkman and Galietta, 2009). The CFTR channel is inhibited by CFTR inhibitor 172 (CFTRinh-172), and only the CFTR channel has been implicated in cAMP-activated Cl− secretion in a variety of epithelia, including the airway and intestine (Riordan, 1993). However, the Epac-activated Cl− secretion in the intestine was resistant to CFTRinh-172, and thus the present study also characterizes this new Cl− conductance biophysically as well as pharmacologically.
MATERIALS AND METHODS
Materials
Cell culture reagents, TRIZOL, Fura2-AM, and BCECF-AM were from Invitrogen. All other reagents were obtained from Sigma-Aldrich, except 8-pCPT-2’-O-Me-cAMP (BioLog Life Science Institute), U73122 (Enzo Life Sciences, Inc.), Gö6976 and CFTRinh-172 (EMD), glibenclamide (Research Biochemicals, Inc.), and Epac1 and Epac2 antibodies (sc-28366 and sc-28326, respectively; Santa Cruz Biotechnology, Inc.).
Cell culture and Ussing chamber setup
T84 cells were grown as confluent monolayers in a 1:1 mixture of Dulbecco's modified Eagle's medium (DMEM) and Ham's F-12 medium supplemented with 40 µg/ml penicillin, 90 µg/ml streptomycin, and 10% fetal bovine serum. Only monolayers with resistances in the range of 1,500 to 3,000 Ω·cm2 were used for experiments, and these were mounted between two halves of an Ussing chamber for short circuit current (Isc) measurement, which was done at 37°C with both sides of the monolayer immersed in an oxygenated HCO3−-free solution containing (in mM) 140 NaCl, 5 KCl, 1 MgCl2, 2 CaCl2, 10 HEPES, and 10 glucose, pH 7.4. 5 ml of fluid in each half of the chamber was connected via KCl agar bridges to voltage and current electrodes and clamped at 0 mV using VCC MC6 multi-channel voltage–current clamp amplifier (Physiologic Instruments). T84 cells with a stable knockdown of Epac1 (T84Epac1KD) were grown on transwell inserts in DMEM plus Ham's F-12 media containing 10 µg/ml puromycin in addition to 40 µg/ml penicillin, 90 µg/ml streptomycin, and 10% fetal bovine serum. These cells were also studied using the same solution mentioned above for Ussing chambers.
Calcium imaging
T84 cells were grown on glass coverslips. Cells were loaded with 2 µM Fura 2-AM in HEPES-buffered salt solution (HBSS; in mM: 135 NaCl, 1.2 MgCl2, 1.2 CaCl2, 10 HEPES, 5 KCl, and 10 glucose, pH 7.4) by incubating for 30–45 min in the dark at 37°C, followed by a 30-min de-esterification in HBSS containing 5 µM indomethacin at room temperature. Fura 2 fluorescence images were monitored at a 510-nm emission with alternating excitation at 340 and 380 nm as described previously (Merlin et al., 1998). Individual Fura-2–loaded T84 cells were selected and [Ca2+]i values were calculated on a pixel-by-pixel basis for data processing using Origin software (OriginLab). For calibration of the Ca2+ indicator, a Fura-2 Ca2+-imaging calibration kit with 0–10 mM CaEGTA (Invitrogen) was used according to the manufacturer's instructions. All measurements shown are representative of a minimum of three independent experiments with no fewer than 50 cells calculated in each study.
Reverse transcription (RT)-PCR
Total RNA was isolated from T84 cells by TRIZOL reagent (Invitrogen). cDNA was synthesized from total RNA using random hexamers and superscript II RT. 1 µl of the first-strand cDNA product was then used as template for PCR amplification with Taq DNA polymerase by 30 thermocycles of 94°C for 1 min, 54°C for 1 min, and 72°C for 1 min using oligonucleotides specific for Epac1 (sense: TTCCTCCAGAAACTCTCAG; antisense: TCAGCTCATGCGCTTCCTG; size of PCR product is 460 bp) and Epac2 (sense: CTCATTGAACCTCACGTTCC; antisense: AGTCATCTCCTTCATGCAGG; size of PCR product is 500 bp).
Western blot analysis
Wild-type T84 or Epac-depleted cells (Epac1KDT84) were grown to 100% confluency on transwell permeable supports (in 75-mm dishes; Corning). Cells were scraped in PBS and then homogenized by sonication in RIPA buffer plus protease inhibitor cocktail (1:100; Sigma-Aldrich) to obtain total cell lysates. Total lysates of mouse mucosal cells were prepared from scrapings of duodenum, jejunum, ileum, or colon as described previously (Hillesheim et al., 2007). Lysates were analyzed by Western blot using an Epac1 mouse monoclonal and Epac2 rabbit polyclonal antibody, secondary polyclonal goat anti–mouse immunoglobulin G conjugated to Alexa Fluor 680 (Invitrogen), and secondary goat anti–rabbit immunoglobulin G conjugated to IRDye 800 (Rockland Immunochemicals, Inc.). The expression of CFTR was determined by antibody 5959, which is a rabbit anti–human CFTR R domain polyclonal antibody generated by us to the peptide IEEDSDEPLERRLSLVPDSEQGE. The glyceraldehyde-3-phosphate dehydrogenase antibody was obtained from USBiological. The fluorescence signal was analyzed by the Odyssey Infrared Imaging System (LI-COR Biosciences).
Immunocytochemistry
Confluent T84 cells grown on 25-mm tissue culture inserts (Thermo Fisher Scientific) were fixed on ice in 3% paraformaldehyde solution in PBS (EM grade; Electron Microscopy Sciences). Cells were washed in ice-cold PBS and quenched with 50 mM NH4Cl in PBS for 15 min on ice. Nonspecific staining was blocked in PBS containing 1% BSA and 0.075% saponin for 30 min on ice. An anti–Epac 1 antibody (1:10) was then added for 1 h at room temperature, after which excess antibody was washed in 0.1% BSA in PBS with 0.075% saponin. The cells were then incubated with a goat anti–mouse secondary antibody conjugated to Alexa 568 for an additional hour. After extensive washing of excess secondary antibody, cells were incubated with Hoechst 33324 (Invitrogen) and mounted on microscope slides. Microscopy was performed using an LSM 510 (Carl Zeiss, Inc.).
Activation of Ras-related protein 2 (Rap2)
Activation of Rap2 was determined by the EZ-Dectect Rap activation kit (Thermo Fisher Scientific) with slight modifications. In brief, T84 cells were incubated with or without FSK and 50 µM 8-pCPT-2’-O-Me-cAMP for 20 min at 37°C. These cells were lyzed with 25 mM Tris/HCl, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1% NP-40, 1 mM DTT and 5% glycerol, 10 mM NaF, and 1 mM Na3VO4 in the presence of a protease inhibitor cocktail (Sigma-Aldrich). After centrifugation at 16,000 g at 4°C for 15 min to remove insoluble materials, the supernatants (700 µg of protein) were incubated with 20 µg of glutathione-S-transferase–tagged RalGDS-RBD (Ras-binding domain of the Ral guanine nucleotide dissociation stimulator) and an Immobilized Glutathione Disc (resin; SwellGel) for 1 h at 4°C. The affinity-purified activated Rap proteins (Rap-GTP) were eluted with 50 µl SDS/PAGE sample buffer containing 5% 2-mercaptoethanol and analyzed by Western blotting with anti-Rap2 antibody.
RNA interference
Mission, the RNA interference Consortium (TRC) lentiviral short hairpin RNA (shRNA) constructs, which target against Epac1, were obtained from Sigma-Aldrich (TRCN0000047228, TRCN0000047230, and TRCN0000047231). Lentiviral particles were produced in HEK293T cells grown on 10-cm plates by cotransfecting cells with lipofectamine 2000 with 3 µg pVSVG (vesicular stomatitis virus glycoprotein), 9 µg pCMVΔR8.9, and 12 µg shRNA plasmids. This mixture of lipofectamine and plasmids was added to the cells and incubated for 16 h. Transfection medium was then removed and replaced with fresh culture medium. Viral particles were then collected in 7 ml of medium 48 h after transfection. Viral supernatant was centrifuged at 1,000 rpm for 5 min and stored in aliquots at −80°C. For lentiviral transduction, T84 cells were grown on 35-mm dishes to ∼70% confluency. On the day of transduction, the culture medium was replaced with 2 ml of fresh medium containing 2 mg/µl hexadimethrine bromide (Sigma-Aldrich). 1 ml of lentiviral particles was added to and incubated with cells for 20 h. The lentiviral particles were then removed, and the cells were replaced with fresh culture medium. 48 h after transduction, positively transduced cells were selected with 10 µg/ml of puromycin-containing medium. Empty vector–transduced T84 cells were processed and selected with puromycin in a similar manner.
Measurement of Isc in mouse ileal sheets
All of the experimental protocols performed in this study were approved by the Institutional Animal Care and Use Committee of Johns Hopkins University. Non-fasting male mice (∼35 g) were anesthetized and sacrificed by inhalation of halothane. The distal ileum was removed and partially stripped of serosal muscle layers. The mucosa was mounted in a tissue slider (2.8 × 11–mm aperture for mouse tissue; area, 0.30 cm2) and bathed at 37°C on both sides with an HCO3−-free solution, which was continually circulated with a gas lift oxygenated with 100% O2. After tissues were mounted, the change in Isc was monitored in real time (Hoque et al., 2005).
Measurement of chloride conductance (ICl) in permeabilized T84 monolayers
The effects of FSK and 8-pCPT-2’-O-Me-cAMP on apical membrane ICl were assessed after permeabilization of the basolateral membrane with 50 µg/ml nystatin and the establishment of a basolateral to apical Cl− concentration gradient (Lewis et al., 1977; Mun et al., 1998). 35 µM ouabain was added to the basolateral bath to inhibit the Na+-K+-ATPase (Huflejt et al., 1994). Both apical and basolateral baths were initially filled with a Cl−-free/high K+ solution containing 10 mM sodium gluconate, 140 mM potassium gluconate, 1 mM calcium gluconate, 10 mM glucose, and 10 mM HEPES, pH 7.4. After equilibration, the basolateral solution was replaced with a high Cl−/high K+ solution containing 10 mM NaCl, 140 mM KCl, 1 mM MgSO4, 1 mM CaCl2, 10 mM glucose, and 10 mM HEPES, pH 7.4. 50 µg/ml nystatin was then added to permeabilize the basolateral membrane to potassium and chloride. Under these conditions, there was an agonist-induced ICl as Cl− ions from the cell moved down the concentration gradient through the Cl− channels in the apical membrane. To do a biophysical characterization of the Epac-stimulated Cl− conductance in T84 cells, we measured the I-V relationship. To do this, the voltage across the monolayer was sequentially stepped from a holding voltage of 0 mV to values between −100 and +100 mV in 20-mV increments with a pulse duration of 5 s while the corresponding transepithelial currents were recorded. For the graphical representation of the I/V relationship, we did not use the customary Ussing convention for Iscs, where the voltage is V2-V1, where V1 is basolateral and V2 is apical (apical–basolateral). Instead, we used the physiological convention of inside–outside, which, when the basolateral side has been permeabilized to Cl−, can also be thought of as basolateral–apical. Using the physiological convention allows for a comparison of the I/V obtained here to the I/V relation of other Cl− conductances recorded using patch clamp methodology. A 50-s interval between each pulse was sufficient for recovery from activation. The protocol was performed as described above with basolateral membrane-permeabilized T84 cells and after sustained stimulation with FSK or 8-pCPT-2’-O-Me-cAMP. Finally, we investigated the selectivity of the FSK-activated, CFTR-inhibited Epac-mediated Cl− currents by substituting high concentrations of either I− (150 mM) or Br− (150 mM) on the basolateral side to measure the resulting Isc in permeabilized membranes. The nystatin permeability of Cl−, Br−, and I− is based on their hydrated radius (Cass et al., 1970), which is nearly identical (3.32, 3.30, and 3.31 Å) (Conway, 1981). Therefore, we have assumed an equal nystatin permeability for our selectivity experiments. The relative permeability of Cl−, Br−, and I− was calculated from the Goldman-Hodgkin-Katz equation. Various blockers of epithelial chloride channels such as Zn, Cd, 4,4’-diisothiocyanatostilbene-2,2’-disulphonic acid (DIDS), 5-nitro-2-(3-phenylpropylamino)-benzoate (NPPB), niflumic acid, glibenclamide, and GlyH-101 were used to further characterize this conductance.
Patch clamp recording
Whole cell recordings were performed in Chinese hamster ovary (CHO) cells transiently transfected with a plasmid containing human CFTR tagged with EGFP. Cells were visualized using an Eclipse Fluorescent inverted microscope (Nikon). Whole cell currents were input into an Axopatch 200B amplifier (Axon Instruments) and analyzed using PClamp 9.2 software (Axon Instruments). Cells were bathed in solution containing (in mM): 140 NaCl, 2 CaCl2, 1 MgCl2, 80 D-mannitol, and 10 HEPES, pH 7.4. The pipette solution consisted of (in mM): 135 CsCl, 2 MgCl2, 2 ATP, 10 HEPES, and 0.001 free Ca2+, pH 7.4. The hypertonic bath solution was used to prevent the activation of any swelling activated Cl− conductance.
Statistics
Results were analyzed by the statistic software Origin and presented as means ± SE of at least three independent experiments. Comparisons between means were performed using Student's t tests. Differences among groups were determined using one-way ANOVA and Student-Newman-Keuls posttest. An overall P < 0.05 was considered significant.
Online supplemental material
The supplemental material includes the effect of lanthanum chloride (LaCl3) and 2-APB on FSK-stimulated Isc in T84 cells (Fig. S1) and the effect of U73122 and 1,2-bis-(o-aminophenoxy)-ethane-N,N,N’,N’-tetraacetic acid, tetraacetoxymethyl ester (BAPTA-AM) on vasoactive intestinal peptide (VIP)-stimulated or 8-Br-cAMP-stimulated Cl− secretion in T84 cells (Fig. S2). Fig. S3 shows that the Epac activator 8-pCPT-2’-O-Me-cAMP does not activate CFTR transiently expressed in CHO cells, which express endogenous Epac1. Figs. S1–S3 are available.
RESULTS
PKA-independent effects of FSK-stimulated Cl− secretion in T84 cells
We first tested whether cAMP-stimulated Cl− secretion in T84 cells was exclusively PKA dependent. Cells were grown on transwell supports placed in Ussing chambers containing an HCO3− free Cl− solution. The PKA inhibitor, H89 (1 µM), partially inhibited the effect of FSK (10 µM) (Fig. 1). Similarly, the effect of FSK was partially inhibited by the conventional PKC inhibitor Gö6976 (5 µM), the PLC inhibitor U73122 (10 µM), or the intracellular Ca2+ chelator BAPTA-AM (25 µM). However, a high concentration of H89 (50 µM), which inhibits both PKA and PKC, inhibited ∼90% of the FSK-stimulated Cl− secretion (Hidaka et al., 1990; Davies et al., 2000; Lochner and Moolman, 2006). Therefore, we further tested whether the combination of 1 µM H89 and other kinase inhibitors could completely inhibit the FSK-stimulated Cl− secretion. The effects of 1 µM H89 and 5 µM Gö6976, of 1 µM H89 and 25 µM BAPTA-AM, or of 1 µM H89 and 10 µM U73122 were additive. These results suggested that FSK-stimulated Cl− secretion was both PKA and Ca2+ dependent, and that the Ca2+ effect was additive to the effect of PKA. There was no change in transepithelial resistance before or after BAPTA-AM addition (3,234 ± 117 Ω·cm2 vs. 3,044 ± 135 Ω·cm2, respectively). Similarly, Gö6976, U73122, and H89 did not affect transepithelial resistance (not depicted).
FSK increases [Ca2+]i
We measured the change of [Ca2+]i in T84 cells upon FSK stimulation. The resting level of [Ca2+]i was ∼150 nM (Fig. 2 A). FSK caused a sustained elevation of [Ca2+]i immediately after its addition (Δ[Ca2+]i = 42 ± 10 nM; P < 0.05). We then determined the source of the [Ca2+]i increase by measuring [Ca2+]i in the absence of extracellular Ca2+ and then after the introduction of 1.8 mM Ca2+ to the extracellular medium. Both Ca2+ release and entry were observed after FSK addition (Fig. 2 B). The sustained rise in [Ca2+]i depended on extracellular Ca2+, whereas the initial rise did not. This increase in [Ca2+]i was blocked by preincubation with the PLC inhibitor U73122 (10 µM) (Fig. 2 C). Collectively, these results suggested that the FSK-induced [Ca2+]i rise was PLC mediated. The rise in [Ca2+]i further induced the entry of Ca2+ across the membrane. The latter fact was further supported by the inhibitory effect of LaCl3, a nonspecific membrane Ca2+ channel blocker (Fig. S1 A). 200 µM LaCl3 inhibited the FSK-stimulated Cl− secretion. Similarly, the IP3-induced Ca2+ release inhibitor 2-APB (50 µM) inhibited the FSK-stimulated Cl− secretion (Fig. S1 B). The results from the LaCl3 and 2-APB experiments demonstrated that Ca2+ release from IP3-sensitive internal stores and entry from the extracellular milieu may have a role in FSK-stimulated Cl− secretion.
Expression of Epac in T84 cells
cAMP binds to Epac proteins and subsequently elevates [Ca2+]i (de Rooij et al., 1998; Kawasaki et al., 1998). Therefore, as part of establishing a role for Epac in FSK-stimulated Cl− secretion, we tested whether Epac message or protein is expressed in T84 cells. Using RT-PCR, both Epac1 and Epac2 transcripts were detected (Fig. 3 A). However, by Western blot, Epac1 but not Epac2 protein was present (Fig. 3 B). This is consistent with the observation that Epac2 is predominately expressed in the brain and adrenal gland, whereas Epac1 has ubiquitous expression (de Rooij et al., 1998; Kawasaki et al., 1998). We further studied the distribution of endogenous Epac1 in T84 cells by immunostaining (Fig. 3 C). Epac1 staining (red) of T84 cells was mostly intracellular, as shown by both the vertical XZ image and the horizontal XY image. A control experiment with only secondary antibody did not have specific staining (not depicted).
Role of Epac in FSK-stimulated Cl− secretion in T84 cells
To establish a link from cAMP to PLC/[Ca2+]i/PKC signaling and to support a role for Epac in Cl− secretion, we determined whether 8-pCPT-2’-O-Me-cAMP, an Epac agonist, could stimulate Cl− secretion in T84 cells. As shown in Fig. 4 A, 50 µM 8-pCPT-2’-O-Me-cAMP stimulated Cl− secretion. 8-pCPT-2’-O-Me-cAMP had been shown to selectively stimulate Epac at 50–200 µM (Kang et al., 2003; Holz, 2004; Yip, 2006). We found 100–200 µM 8-pCPT-2’-O-Me-cAMP did not further enhance Cl− secretion in T84 cells (not depicted), suggesting that 50 µM 8-pCPT-2’-O-Me-cAMP already produced a maximal effect. This increase in Isc was completely blocked by pretreatment of the cells with 25 µM BAPTA-AM, but not with 1 µM H89. Therefore, [Ca2+]i, but not PKA, mediated the effect of 8-pCPT-2’-O-Me-cAMP. We hypothesized that if the Epac/PLC/[Ca2+]i/PKC pathway contributed to the PKA-independent component of FSK-stimulated Cl− secretion, the combined effects of PKA and Epac on Cl− secretion in T84 cells would be additive. As shown in Fig. 4 B, the PKA agonist Sp-8-pCPT-cAMP (20 µM) (Christensen et al., 2003) stimulated Cl− secretion. Gradual increases in the concentration of Sp-8-pCPT-cAMP to 100 µM did not further stimulate Cl− secretion (not depicted). However, the addition of the Epac activator (50 µM) further stimulated Cl− secretion. The stimulatory effect of 20 µM Sp-8-pCPT-cAMP and 50 µM 8-pCPT-2’-O-Me-cAMP on Cl− secretion was additive.
We tested whether 10 µM FSK or 50 µM 8-pCPT-2’-O-Me-cAMP was capable of activating Rap2 in T84 cells because activation of Rap2 leads to the activation of PLCε and increased [Ca2+]i (Evellin et al., 2002). As shown in Fig. 5 A, a 20-min treatment of either FSK or 8-pCPT-2’-O-Me-cAMP increased the amount of GTP-Rap2. This result further suggested that Epac was activated by FSK or 8-pCPT-2’-O-Me-cAMP, and that activation of Epac subsequently led to activation of Rap2 and elevation of [Ca2+]i, the latter event caused by selective activation of Epac with 8-pCPT-2’-O-Me-cAMP, leading to a rise of [Ca2+]i (Δ[Ca2+]i = 45 ± 7 nM; n = 3) (Fig. 5 B).
Effect of Epac on apical Cl− conductance
Because Cl− secretion involves the coordinated functions of apical Cl− channels and the basolateral membrane transporters, such as Na/K/ATPase, Na+/K+/2Cl−, and K channels, and the effect of Epac on Cl− secretion appears to be moderate, we addressed whether Epac has any effect on apical Cl− channels and whether this effect is enhanced in cells with the basolateral membrane permeabilized. ICl was measured in T84 monolayers treated with 50 µg/ml nystatin on the basolateral membrane. The permeabilized cells were exposed to a basolateral to apical Cl− gradient (Mun et al., 1998). Treatment with 10 µM FSK led to a brisk and sustained increase in ICl, which represented an activation of apical chloride channels (Fig. 6 A). After the maximal effect of FSK was obtained, the addition of 8-pCPT-2’-O-Me-cAMP had no additional effect on Isc (not depicted). The FSK effect was partially inhibited by BAPTA-AM (Fig. 6 A). 8-pCPT-2’-O-Me-cAMP also increased apical ICl in basolaterally permeabilized cells. In contrast to FSK, the 8-pCPT-2’-O-Me-cAMP–stimulated apical ICl was completely inhibited by BAPTA-AM (Fig. 6 B).
Effect of BAPTA and U73122 on VIP- and 8-Br-cAMP–stimulated Cl− secretion in T84 cells
VIP acts through a G protein–coupled receptor that activates Gs/adenylate cyclase to increase intracellular cAMP. The cAMP analogue 8-Br-cAMP activates PKA and possibly Epac as well (de Rooij et al., 1998; Kawasaki et al., 1998). We tested whether these two agents stimulated Cl− secretion in a manner similar to FSK. As shown in Fig. S2 A, BAPTA-AM and U73122 significantly reduced the VIP (100 nM) -stimulated Cl− secretion. Similarly, BAPTA-AM and U73122 also inhibited 8-Br-cAMP (100 µM) -stimulated Cl− secretion (Fig. S2 B). These findings suggested that a rise of [Ca2+]i is involved in G protein–coupled receptor–mediated and the cAMP-dependent process of Cl− secretion in T84 cells.
Role of Epac in FSK-stimulated net ion transport in mouse ileum
To determine whether the stimulation of Cl− secretion by Epac1 is a general mechanism of regulating intestinal Cl− secretion, we determined that Epac1 was expressed in different segments of mouse intestine, including duodenum, jejunum, ileum, and colon, suggesting that this pathway could be activated along the intestine (Fig. 7 A). 8-pCPT-2’-O-Me-cAMP stimulated net ion transport in mouse ileum, and this was not inhibited by 1 µM H89 but was inhibited by BAPTA-AM treatment (Fig. 7 B). The 8-pCPT-2’-O-Me-cAMP–stimulated ICl in mouse ileum, with the basolateral membrane permeabilized with nystatin, was not inhibited by the CFTRinh-172 (Fig. 7 C).
Epac1 silencing in T84 cells
To further establish the role of Epac1 in FSK-stimulated Cl− secretion, lentivirus containing shRNA against Epac1 was used to silence Epac1 protein expression in T84 cells. We used three different TRC shRNA constructs, which had not previously been experimentally validated (as described in Materials and methods). Lentiviral particles were prepared from each shRNA construct and transduced into T84 cells. Cells resistant to puromycin were selected and characterized by Western blot. Of the three shRNA constructs tested, only the constructs 228 (referring to the last three digits of the TRC number) and 231 were able to reduce the expression of Epac1 in T84 cells by 89 and 76%, respectively, as determined by Western blot densitometry. However, the construct 230 failed to silence Epac1 (Fig. 8 A). There was no change in the expression of CFTR protein between the wild-type cells, vector-transduced cells, and cells transduced with putative Epac1 shRNA constructs. The functional consequence of Epac1 silencing with respect to FSK-stimulated Cl− secretion was tested using these cell lines. As shown in Fig. 8 B, the Epac1KDT84cst228 and Epac1KDT84cst231 cells exhibited only ∼43–50% of FSK-stimulated Cl− secretion compared with wild-type and vector-transduced cells. In contrast, the Epac1KDT84cst230 cells having the shRNA construct 230 that failed to silence Epac1 protein responded to FSK with a similar magnitude of Cl− secretion as wild-type and vector-transduced cells. FSK-stimulated Cl− secretion in Epac1KDT84cst228 cells was inhibited by 1 µM H89, but not by U73122 and BAPTA-AM (Fig. 8 C), confirming that in the absence of Epac1, FSK-stimulated Cl− secretion was completely PKA dependent. FSK and the Epac activator also failed to elevate [Ca2+]i in these Epac-silenced cells (not depicted).
Epac-mediated chloride currents are not caused by CFTR
To further confirm that Epac1-mediated Cl− secretion in T84 cells was not due to CFTR, we transiently transfected CHO cells that express endogenous Epac1 with a CFTR construct. Then, Cl− currents were recorded in the whole cell configuration (Lorenowicz et al., 2006). As shown in Fig. S3 (A–C), 100 µM 8-pCPT-2’-O-Me-cAMP had no effect on current amplitudes (233.9 ± 65.2 pA vs. 203.7 ± 58.3 pA; P = 0.29), whereas subsequent application of a CFTR-stimulating cocktail of 100 µM cpt-cAMP plus 10 µM FSK activated large, linear CFTR currents (1,334.7 ± 250.5 pA; P ≤ 0.005) (Fig. S3, A and B). The cpt-cAMP/FSK–activated currents were inhibited by the application of 10 µM CFTR inh-172 (I(pA) = 392.7 ± 149.7; P ≤ 0.01). The cpt-cAMP/FSK–activated Cl− currents and the inhibition by 10 µM CFTRinh-172 demonstrated that the Cl− conductance stimulated by cpt-cAMP/FSK was specifically a CFTR-mediated conductance.
Biophysical properties of the Epac-stimulated Icl
We characterized the biophysical properties of the secretory currents activated by Epac. We took advantage of the basolateral-permeabilized membrane protocol to isolate the channel currents at the apical surface, allowing a description of the I-V relationship and measurement of the reversal potential. In Fig. 9 A, we plotted the current against the clamped, stepped voltages of T84 monolayers with permeabilized basolateral membranes in the presence of 50 µM 8-pCPT-2’-O-Me-cAMP. The recorded currents had significant inward rectification with a reversal potential of 39 mV. The only non-balanced ion/anion was Cl− with a Nernst potential of 90.0 mV, somewhat dissimilar from that of the Nerst potential of the Epac-stimulated current. This discrepancy might be due, in part, to the small amplitude of the recorded current, suggesting that the Epac activator did not fully stimulate the Cl− current. This drawback, along with our inability to use large amounts of the 8-pCPT-2’-O-Me-cAMP compound because of its scarcity, led us to rely on FSK activation of the Epac currents with and without CFTRinh-172. Fig. 9 B reveals that outward FSK-activated currents (black squares) had large amplitudes and were somewhat linear, but the apical application of the CFTRinh-172 decreased the current amplitude and changed the shape of the I-V relationship. The FSK plus CFTRinh-172 currents were inwardly rectifying, similar to the currents activated by 8-pCPT-2’-O-Me-cAMP (Fig. 9 B). In either case, it is important to note that K+ ions at nonzero potentials could possibly be contributing to the I-V shape through yet unknown apical K+ channels, although unlikely in secretory T84 cells.
We next measured the reversal potentials for the FSK-activated currents with or without the CFTRinh-172 and with or without a steep basal to apical Cl− gradient (Fig. 9 C). The FSK-activated chloride current had a reversal potential of 76 mV (Erev Cl− = 90.0 mV), indicating that the largest apical ion conductance was a Cl− conductance (all other permeant ions had a zero Nernst potential), a conductance that had been shown many times to be largely mediated by CFTR. The application of the CFTRinh-172 shifted the reversal potential to 52 mV. The shift represented the loss of the Cl− conductance through CFTR channels on the apical membrane, suggesting that the remaining current was the Epac-activated Cl− conductance and a sizable but unchanging leak current (Eleak = 0 mV). Balancing Cl− on either side of the apical membrane (new ECl− = 0 mV) shifted the reversal potential to 6 mV, demonstrating the Epac-mediated current was a Cl− current. Using Fick's first law, we next calculated the absolute permeabilities of Cl−: PCl− = JCl− (mmol/cm2*s)/([Cl− in] − [Cl− out])(mmol/cm3), where JCl− = (ICl− at 0 mv)/Faraday constant. The calculated PCl− for the FSK-activated currents was 16.04 × 10−6, very similar to that reported previously (13.1 ± 1.8 × 10−6; Huflejt et al., 1994) also in T84 cells. The CFTRinh-172-inhibited current had a PCl− = 8.61 × 10−6, a sizable Cl− permeability and larger than that measured for carbachol-activated chloride currents (Huflejt et al., 1994). Finally, we investigated the permeability of the Epac-mediated Cl− currents (Fig. 9 D). We substituted either I− or Br− on the basolateral side and measured the Isc with basolateral-permeabilized membranes. We found that Cl− was more permeable than either I− or Br−, with a selectivity sequence of Cl−>Br−>I− and relative permeabilities of PCl−/PCl− = 1, PBr-/PCl− = 0.9, and PI-/PCl− = 0.6. The anion permeability through nystatin pores is based on hydrated ion radius (Cass et al., 1970), and Cl−, Br−, and I− have essentially the same hydrated radius (3.32, 3.30, and 3.31 Å) (Conway, 1981) and thus predictive similar nystatin permeabilities.
To identify blockers of the apical Cl− conductance involved in the Epac-mediated Cl− secretion, the 8-pCPT-2’-O-Me-cAMP–stimulated ICl was challenged with 5 µM of the CFTRinh-172 (Ma et al., 2002; Factor et al., 2007) or 100 µM glibenclamide (Schultz et al., 1996; Sheppard and Robinson, 1997). Other inhibitors added were 100 µM niflumic acid, which inhibits the calcium-activated Cl− channel (CaCC), 100 µM zinc (Zn2+), and 1 mM cadmium chloride (Cd2+), which inhibits the voltage-gated Cl− channel isoform 2 (ClC2). The lack of effect of these inhibitors suggested that CFTR, CaCC, and ClC2 were not responsible for Epac-mediated Cl− secretion (Fig. 10 A). To ascertain that cAMP-stimulated Cl− secretion occurs through two different Cl− channels, we measured ICl in basolaterally permeabilized T84 cells in the presence of either CFTRinh-172 plus DIDS or CFTRinh-172 plus NPPB. Fig. 10 B shows that the combined effect of CFTRinh-172 along with either DIDS or NPPB was greater compared with CFTRinh-172 alone. Thus, these two inhibitors partially inhibited a component of the cAMP-stimulated Cl− secretion in intact T84 cells (not depicted; Merlin et al., 1998). Interestingly, we have found that the cAMP-stimulated apical ICl was completely inhibited by GlyH-101(Fig. 10 C), a previously considered CFTR blocker but now known to also block CaCCs (Hartzell et al., 2009).
DISCUSSION
PKA has been regarded as the major and only effector of cAMP in modulating CFTR function in the apical membrane of intestinal and airway cells (Vajanaphanich et al., 1995; Barrett, 2000; Huang et al., 2000; Boucher, 2007; Thelin and Boucher, 2007). However, Merlin et al. (1998) showed that FSK is capable of elevating [Ca2+]i in intestinal T84 cells, in addition to increasing intracellular cAMP concentrations (Merlin et al., 1998; Holz, 2004). This suggests that [Ca2+]i might also be involved in intestinal Cl− secretion as a consequence of FSK stimulation. The mechanism by which FSK elevates [Ca2+]i has not been clear. Epac is a cAMP-binding protein that transduces cAMP signaling into increases in [Ca2+]i (Schmidt et al., 2001). Because both PKA and Epac are broadly expressed in many tissues and are activated by binding to cAMP with similar affinity (de Rooij et al., 1998; Kawasaki et al., 1998; Schmidt et al., 2001), an increase in intracellular cAMP will likely lead to activation of both PKA and Epac.
Our data showed that both PKA and PLC/[Ca2+]i/PKC pathways were involved in FSK-stimulated Cl− secretion and their effects were additive. It was shown that H89 inhibits PKA in nanometer concentrations (IC50 = 48 nM), whereas at micrometer (IC50 = 14 µM) concentrations, it inhibits PKC as well (Chijiwa et al., 1990; Hidaka et al., 1990; Hidaka and Kobayashi, 1992; Muroi and Suzuki, 1993; Davies et al., 2000; Lochner and Moolman, 2006). Thus, 1 µM H89 has been used to selectively inhibit PKA, for example, in studies demonstrating adenosine-induced PKA activation of K+ channel currents in arterial myocytes (Kleppisch and Nelson, 1995) and for distinguishing between PKA-dependent and -independent apical exocytosis of aquaporin-2 in renal inner medullary collecting duct cells (Yip, 2006). In our studies, 1 µM H89 was used to inhibit the PKA-dependent component of FSK-stimulated Cl− secretion. It was found that 1 µM H89 only partially inhibited FSK-stimulated Cl− secretion, which was also partially inhibited by U73122, Gö6976, and BAPTA-AM. The effects of H89 and Gö6976, of H89 and BAPTA-AM, or of H89 and U73122 were additive. These results suggested the presence of a Ca2+-sensitive, PKA-independent component of Cl− secretion. The cAMP secretagogue, VIP, and 8-Br-cAMP had the same effect as FSK. Furthermore, FSK increased [Ca2+]i in T84 cells. Thus, our observation confirmed the finding of Merlin et al. (1998), that FSK induced a moderate increase in [Ca2+]i. It is worthwhile to note that FSK/cAMP is also found to increase [Ca2+]i in chicken enterocytes (Semrad and Chang, 1987) and intestinal HT29 cells (Denning et al., 1994). In addition, apical adenosine, acting via cAMP, has recently been shown to regulate basolateral Ca2+-activated K channels in Calu-3 cells via PLC- and Ca2+-dependent signaling pathways (Wang et al., 2008). FSK/cAMP is also able to mobilize [Ca2+]i in inner medullary collecting duct cells(Yip, 2006), rat cardiac myocytes (Pereira et al., 2007), and HEK293 cells(Schmidt et al., 2001) and increases Ca2+-induced Ca2+ release in pancreatic β cells (Dyachok et al., 2004; Dyachok and Gylfe, 2004; Holz, 2004). These studies also support the link between cAMP with Ca2+ mobilization as observed in our studies.
Upon binding cAMP, Epac activates Rap GTPases, which stimulate PLCε and mobilize [Ca2+] from intracellular stores (Schmidt et al., 2001). PLC is involved in FSK, VIP, or 8-Br-cAMP increases in Cl− conductance because the conductance is partially inhibited by the PLC inhibitor, U73122. The effect of Epac and FSK on [Ca2+]i is completely abolished by U73122. Among various PLC isoforms, PLCε is an effector of Ras. Association of Ras and Rho proteins with the Ras-binding domains of PLCε activates the phospholipase activity of the enzyme (Maly et al., 2007). The direct involvement of Epac in Cl− secretion was indicated by the use of the Epac activator, which activates Rap2, elevates [Ca2+]i, and stimulates Cl− secretion. 8-pCPT-2’-O-Me-cAMP also stimulated net ion transport in mouse ileum independently of PKA. Furthermore, other evidence confirming the role of the Epac pathway after increases in cAMP came from our studies on Epac1KDT84cst228 and Epac1KDT84cst231 cells that exhibited >75% reduction in expression of Epac1 protein and responded to FSK-stimulated Cl− secretion with only half the magnitude as that of wild-type and vector-transduced cells. Most importantly, this reduction in Isc response to FSK was not due to a change in CFTR protein. Our studies also found that the construct TRCN000047230 failed to silence Epac1; therefore, Epac1KDT84cst230 cells were considered a negative control in addition to the vector-transduced cells. FSK-stimulated Cl− secretion in Epac1KDT84cst228 cells was completely dependent on PKA, no longer dependent on PLC, and insensitive to BAPTA-AM treatment. Thus, these studies provide compelling evidence that Epac contributed to the FSK-stimulated Cl− secretion.
Previous studies by Vajanaphanich et al. (1995) demonstrated a synergistic Cl− secretion in T84 cells in response to simultaneous elevation of cAMP and Ca2+. Based on the model of intestinal Cl− secretion, which involves basolateral Na+/K+/2Cl− cotransporter and K+ channels as well as apical Cl− channels, possible mechanisms of synergism include cooperative effects of cAMP and Ca2+ on the apical Cl− conductance and/or stimulated opening of Ca2+-regulated basolateral K channel (Anderson and Welsh, 1991; Reenstra, 1993; Barrett and Keely, 2000). Therefore, we tested whether sequential addition of Sp-8-pCPT-cAMP and 8-pCPT-2’-O-Me-cAMP would result in synergistic response to Cl− secretion. Our result suggested that the effects of Sp-8-pCPT-cAMP and 8-pCPT-2’-O-Me-cAMP were additive. Because the order of addition might affect the outcome (Vajanaphanich et al., 1995), we challenged T84 cells with the addition of 8-pCPT-2’-O-Me-cAMP followed by Sp-8-pCPT-cAMP, and the same result was obtained (not depicted). In addition, when the maximal effect of FSK alone was obtained, the Epac pathway appeared to have been fully activated, as there was no additional effect on Isc by Epac stimulator addition. To reconcile the synergistic effect on Cl− secretion by the combined addition of cAMP and carbachol and the additive effect of Sp-8-pCPT-cAMP and the Epac activator, it should be pointed out that the Ca2+-elevating agent carbachol acts through the Gq-coupled receptor. Different pools of intracellular Ca2+ might have been mobilized by Epac and carbachol, and consequently, their downstream signaling events and effects on Cl− secretion would be predicted to be different. In addition, the effect of carbachol on Cl− secretion is transient (Vajanaphanich et al., 1995; Barrett, 2008), whereas that of Epac is sustained. Carbachol elevates [Ca2+]i by 350–450 nM (Vajanaphanich et al., 1995), whereas the effect of Epac on [Ca2+]i is 50 nM (Fig. 5 B). This moderate elevation of [Ca2+]i and its source from a pool probably distinct from that sensitive to carbachol either does not or is insufficient to fully activate Ca-dependent basolateral K+ channels, which might provide additional driving force for Cl− to exit across the apical membrane. Therefore, carbachol exerts a synergistic effect with cAMP on Cl− secretion, whereas the Epac effect is additive to Sp-8-pCPT-cAMP. In fact, the basolateral membrane also limits the effect of Epac alone on Cl− secretion. In intact cells, the Epac agonist only had a modest effect. When the basolateral membrane was permeabilized, the Epac agonist had a more enhanced effect on apical Cl− conductance, which was ∼40–50% of that produced by FSK (compare Fig. 6, A with B). This means that fully half of the FSK-stimulated Cl− conductance at the apical membrane was not due to CFTR. A working model of FSK stimulation of Cl− secretion in T84 cells is depicted in Fig. 11. This model demonstrates that activation of adenylate cyclase by FSK results in formation of cAMP. Because the effect of FSK could be reproduced by 8-Br-cAMP and by VIP, and the effect of Epac was PKA independent, these findings suggest that PKA and Epac1 are independent downstream effectors of cAMP. Epac1 activates Rap2, which then leads to an increase in [Ca2+]i. PLCε is activated by small GTPases, such as Ras and Rho(Schmidt et al., 2001), and the involvement of PLC was indicated by the elevation of [Ca2+]i by FSK, which was completely blunted by U73122, and that FSK-stimulated Cl− secretion was partially blunted by U73122. Because FSK-stimulated Cl− secretion was inhibited by Gö6976, which selectively inhibits the Ca2+-sensitive conventional PKC isoforms PKCα, PKCβ, and PKCγ, candidate PKC isoforms are involved in secretion (Doolen and Zahniser, 2002). We conclude from all of this that the final outcome of Epac activation is a Cl− secretion through a yet-to-be identified channel. This pathway of enhanced Cl− secretion, independent of the CFTR channel, might be useful in treating cystic fibrosis where the CFTR channel is defective. Thus, Epac1 transduces cAMP signaling into Ca2+ signaling, providing an additional pathway to manifest the effects of cAMP on intestinal Cl− secretion.
To compare the Epac-stimulated Cl− current to previously identified intestinal epithelial channels, we characterized its ion selectivity, I-V characteristics, and blocker sensitivity. The Epac-mediated current was inwardly rectifying, was sensitive to BAPTA-AM and thus Ca2+ sensitive, had a halide selectivity of Cl−>Br−>I−, and was not sensitive to Cd2+, Zn2+, CFTRinh-172, or niflumic acid, but was sensitive to DIDS, NPPB, and GlyH-101. CFTR Cl− currents are distinguished by a linear I-V relation, lack of a time-dependent current decay, activation by PKA, and inhibition by diphenylamine-2-carboxylate, glibenclamide, and CFTRinh-172, but not by DIDS (Gray et al., 1993; McCarty et al., 1993). The halide selectivity sequence most commonly reported for CFTR is Br−>Cl−>I− (Riordan, 1993). CFTR channels also have a single-channel conductance of 4–10 pS (Fuller and Benos, 2000). In our study, when CHO cells that have endogenous Epac expression(Lorenowicz et al., 2006) were transiently transfected with a plasmid containing human CFTR, 8-pCPT-2’-O-Me-cAMP did not increase the current amplitude, whereas subsequent application of a CFTR-stimulating cocktail of 100 µM cpt-cAMP plus 10 µM FSK activated large, linear currents (Fig. S3). The cpt-cAMP/FSK–activated currents were inhibited by the application of 10 µM CFTRinh-172, demonstrating that the Cl− conductance stimulated by cpt-cAMP/FSK was a CFTR-mediated conductance. Therefore, it appears that in cells containing CFTR, but not the complete complement of endogenous Cl− channels found in intestinal epithelial cells, 8-pCPT-2’-O-Me-cAMP fails to activate a Cl− conductance, strongly supporting our hypothesis that Epac1 does not activate CFTR but another yet unidentified Cl− channel. The involvement of a non-CFTR Cl− channel was strongly indicated by the observation that a specific CFTR channel blocker, CFTRinh-172, partially inhibited the cAMP-stimulated Cl− secretion but was not able to inhibit 8-pCPT-2’-O-Me-cAMP–stimulated apical Cl− conductance in T84 cells, and that 8-pCPT-2’-O-Me-cAMP itself was unable to activate a CFTR current.
In the past, there were conflicting results about the presence of apical Ca2+-activated Cl− channels in T84 cells. When nystatin was used to permeabilize basolateral membranes of T84 cells, there was no evidence of Ca2+-stimulated Icls (Anderson and Welsh, 1991; Reenstra, 1993). However, other studies showed that carbachol or thapsigargin increased a Cl− conductance in T84 cells (Barrett et al., 1998; Merlin et al., 1998). The presence of apical Ca2+-sensitive Cl− conductances in T84 cells was further supported by whole cell patch clamp studies in which Cliff and Frizzell (1990) showed cAMP- and Ca2+-stimulated different Cl− conductances. Merlin et al. (1998) showed similar results that cAMP increased at least two current components, one of which has features in common with that elicited by Ca2+-elevating agents. Ca2+-activated Cl− channels generally display I−>Br−>Cl− permeability sequence (Evans and Marty, 1986). The molecular identity of the proteins underlying the ubiquitously expressed Ca2+-dependent anion conductance has remained elusive. CaCC conductances are generally inhibited by DIDS and niflumic acid but have varying responses to NPPB. These channels are also diverse in their biophysical properties, for example, with single-channel conductances ranging from 1 to 70 pS and rectification ranging from strong outward to relatively linear I-V relationships (Marty et al., 1984; Klöckner, 1993). On the other hand, the ubiquitously expressed ClC2, also found to mediate Cl− secretion in many epithelia, including Caco-2 and T84 monolayers (Gyömörey et al., 2000; Mohammad-Panah et al., 2001; Cuppoletti et al., 2004), has a single-channel conductance of ∼2–3 pS (Jordt and Jentsch, 1997; Gyömörey et al., 2000). Finally, ClC-2 has a Cl−>I− selectivity and is inhibited by Zn2+ and Cd2+ (Schwiebert et al., 1998; Jentsch et al., 1999).
Our data show that Epac1 signaling stimulates an inwardly rectifying current that is not blocked by Cd2+, Zn2+, niflumic acid, CFTRinh-172, or glibenclamide when the current is directly stimulated by 8-pCPT-2’-O-Me-cAMP. Cl− currents are completely inhibited by DIDS or NPPB (also blockers of CaCC) when FSK in the presence of CFTRinh-172 is used as stimulus. The FSK-stimulated current is completely blocked by GlyH-101. Although GlyH-101 was a drug often considered as CFTR selective, it also blocks ANO1 (a recently cloned CaCC channel) with high potency (Hartzell et al., 2009). Based on the criteria of rectification and blocker sensitivity, we conclude that the Epac-stimulated channel is not the recently identified CaCC, now called ANO1 (TMEM16A) (Yang et al., 2008). The characteristics of the Epac-mediated Cl− current of T84 cells do not neatly fit the characteristics of any known epithelial Cl− channel. There was reasonable evidence in our study to indicate that FSK- and 8-pCPT-2’-O-Me-cAMP–increased [Ca2+]i in T84 cells was required for some of the actions of cAMP, “the Epac1–Ca2+ pathway” in the activation of Cl− conductances. It is possible this new conductance is another undocumented calcium-activated Icl.
In summary, this study identifies an additional cAMP signaling pathway that activates a PKA-independent, Epac-mediated intestinal Cl− secretion in T84 cells and net ion transport in mouse ileum. The Icl activated by Epac that we have identified and given an initial biophysical characterization might be useful in cystic fibrosis disease by providing an alternative source of chloride movement when the CFTR channel is defective.
Acknowledgments
We thank Dr. Mark Donowitz for critical reading of the manuscript.
This work was supported by the Johns Hopkins Center for Global Health (grant 80019485 to C.-M. Tse) and the National Institutes of Health/NIDDK Hopkins Digestive Disease Basic Research Development (grant R24DK064399; mouse core to S.E. Guggino and C.-M. Tse). The Cystic Fibrosis Foundation supported S.E. Guggino (grant R025-CR07).
Angus C. Nairn served as editor.
References
- BAPTA-AM
1,2-bis-(o-aminophenoxy)-ethane-N,N,N’,N’-tetraacetic acid, tetraacetoxymethyl ester
- [Ca2+]i
intracellular calcium
- CaCC
calcium-activated Cl− channel
- CFTRinh-172
CFTR inhibitor 172
- CHO
Chinese hamster ovary
- CLC2
Cl− channel isoform 2
- DIDS
4,4’-diisothiocyanatostilbene-2,2’-disulphonic acid
- Epac
exchange protein directly activated by cAMP
- FSK
forskolin
- ICl
chloride conductance
- Isc
short circuit current
- LaCl3
lanthanum chloride
- NPPB
5-nitro-2-(3-phenylpropylamino)-benzoate
- Rap2
Ras-related protein 2
- RT
reverse transcription
- shRNA
short hairpin RNA
- TRC
the RNA interference consortium
- VIP
vasoactive intestinal peptide
