HEK293T cell TMEM175-KO lines. (A and B) Sequence deletions in the two TMEM175-KO HEK293T lines with out-of-frame disruptions, TMEM175 KO/5 (A) and TMEM175 KO/19 (B) used in the study. Position of deletion (A) and replacement (B) are indicated by arrows below the Sanger sequencing chromatograms. Sequencing in A was from a cell lysate PCR sample showing a homozygous deletion of 8 bp in the open-reading frame. Clone HEK-KO19 (B) is heterozygous for two alleles with different lengths of deletions, one with 35 bp deleted and the other with 3 bp replaced by an insertion of 1 bp. The sequences are from cell lysate PCR cloned into pBlueScript plasmid vector. Sequence in region of WT is 5′-ACAGGCACACTCAGACCTGCCTTTCCTCCCAGGCTCCTGTAACCGCCAGGCAGCGGCCCCGCCATGTCCCAGCCCCGGACCCCAGAGCAGGCACTGGATACACCGGGGGACTGCCCCCCAGGCAGGAGAGACGAGGACGCTGGGGAGGGGATCCAGTGCTCCCAACGCATGCTCAGCTTCAGTGACGCCCTGCTGTCCATCAT-3′.
Sharing content requires targeting cookies to be enabled. Please update your cookie preferences to use this feature.