| Primer | Sequence |
|---|---|
| Rac3 G12V forward | ggtcggcgacgtcgccgtgggga |
| Rac3 G12V reverse | tccccacggcgacgtcgccgacc |
| Rac3 T17N forward | gacggcgccgtggggaagaattgcttgctgatc |
| Rac3 T17N reverse | gatcagcaagcaattcttccccacggcgccgtc |
| Rac3 Q61L forward | ggacacagcgggtctggaggactacgatc |
| Rac3 Q61L reverse | gatcgtagtcctccagacccgctgtgtcc |
| Rac3 T35S forward | cccggagagtacatccccagcgtttttgacaac |
| Rac3 T35S reverse | gttgtcaaaaacgctggggatgtactctccggg |
| Rac3 Y40C forward | caccgtttttgacaactgctctgccaacgtgatgg |
| Rac3 Y40C reverse | ccatcacgttggcagagcagttgtcaaaaacggtg |
| Primer | Sequence |
|---|---|
| Rac3 G12V forward | |
| Rac3 G12V reverse | |
| Rac3 T17N forward | |
| Rac3 T17N reverse | |
| Rac3 Q61L forward | |
| Rac3 Q61L reverse | |
| Rac3 T35S forward | |
| Rac3 T35S reverse | |
| Rac3 Y40C forward | |
| Rac3 Y40C reverse |
Sharing content requires targeting cookies to be enabled. Please update your cookie preferences to use this feature.