| Primer | Sequencea | Location |
|---|---|---|
| Cloning | ||
| 5′-arm forward | AACTCGAGGATATCAAGATGATGGTGCCCATTAC | 34739922–34739944b |
| 5′-arm reverse | GAGAATTCTCCATAAATATGACAGGAAGAGTAG | 34740097–34740121b |
| 3′-arm forward | AAGGATCCCTTCTCTACCACTTAGAACCAAG | 34774307–34774329b |
| 3′-arm reverse | ATCATACCGCGGATATCAACTTATGACCGTACCAACTG | 34774490–34774510b |
| Southern | ||
| Cald1 forward | CTACCACAAACCTTACTGCTGAGC | 69123–69100c |
| Cald1 reverse | GGTGCTGGCCTCATTGAAAA | 68582–68601c |
| COL12A1 forward | GATGGTACTTACAGATATATGG | Collagen, type XII α1 |
| 126865–126844c | ||
| COL12A1 reverse | GCAAAGAGGAGCAGGAAAAGG | Collagen, type XII α1 |
| 126242–126262c | ||
| Genotyping | ||
| Cald1 forward | CATCAAGTCCTACCAGAAGAA | 80083–80063d |
| Cald1 reverse | CCCTTTCATTCACTCCTTTCC | 79392–79412d |
| neomycin | CATCGCATTGTCTGAGTAGG | Neomycin |
| Cald1 reverse | TTTGTACAATGACGCTGTATGC | 51269–51290d |
| Primer | Sequence | Location |
|---|---|---|
| 5′-arm forward | 34739922–34739944 | |
| 5′-arm reverse | 34740097–34740121 | |
| 3′-arm forward | 34774307–34774329 | |
| 3′-arm reverse | 34774490–34774510 | |
| Cald1 forward | 69123–69100 | |
| Cald1 reverse | 68582–68601 | |
| COL12A1 forward | Collagen, type XII α1 | |
| 126865–126844 | ||
| COL12A1 reverse | Collagen, type XII α1 | |
| 126242–126262 | ||
| Cald1 forward | 80083–80063 | |
| Cald1 reverse | 79392–79412 | |
| neomycin | Neomycin | |
| Cald1 reverse | 51269–51290 |
Gene-specific sequence is underlined.
CaD 1, GeneID accession number 109624; chromosome 6, NC_000072.6.
Mus musculus BAC clone RP24-141A7 from chromosome 9, GenBank accession number AC157477.2.
Mus musculus 6 BAC RP23-104H13, complete sequence.
Sharing content requires targeting cookies to be enabled. Please update your cookie preferences to use this feature.