Skip to Main Content
Table 3.

List of primers used in this study

ID Sequence 5′ to 3′ Restriction sites 
FLAG-S GATCTGATTACAAGGATGACGACGATAAGCTCGAGGGCGGCCGCGGAA BglII, XhoI, NotI, and HindIII 
FLAG-AS AGCTTTCCGCGGCCGCCCTCGAGCTTATCGTCGTCATCCTTGTAATCA BglII, XhoI, NotI, and HindIII 
Ku70-F CCGCTCGAGTCAGGGTGGGAGTCATATTACAAAACC XhoI 
Ku70-R GGCGGATCCTTAGTCCTGGAAGTGCTTGGTGAGG BamHI 
Ku80-F GGCCTCGAGGTGCGGTCGGGGAATAAGG XhoI 
Ku80-R CGCGGATCCTATCATGTCCAATAAATCGTCCACATCACC BamHI 
XRCC4-F CCGCTCGAGGACTACAAGGACGATGACGACAAGGGATCC XhoI 
XRCC4-R GGCGAATTCTTAAATCTCATCAAAGAGGTCTTCTGG EcoRI 
AAVMCS-F CGCGCGGCCGCGCTAGCGAATTCGCAGCTGTTGTGCTGTGTATGG NotI, NheI, and EcoRI 
AAVMCS-R CGCGGGCCCACGCGTGGATCCCATCAACAGCATTCAACTGTGCC BamHI, MluI, and Bsp12OI 
Ku70-HA1-F CGCGCGGCCGCGAAGACTGCTTGGTGAATTCTGGAGTTCGG NotI 
Ku70-HA1-R GCCGCTAGCCATGTTGGCTACTGCTCACTAGGCG NheI 
Ku70-GFP-F GCCGCTAGCAAGGGCGAGGAGCTGTTCACCG NheI 
Ku70-GFP-R GGCACCGGTCTTATCGTCGTCATCCTTGTAATCAG AgeI 
Ku70-HA2-F CCGACCGGTTCAGGGTGGGAGTCATATTACAAAACC AgeI 
Ku70-HA2-R CCGACGCGTCAGTGAACCGAGATTGAGTCAGTGC MluI 
GFP-F GGCAAGCTTACCGGTCGCCACCATGGTGAGCAAGGGCG HindIII and AgeI 
GFP-R CCGCTCGAGCTTATCGTCGTCATCC XhoI 
Ku70siR-R GGCACGCGTGCGGCCGCTTAGTCCTGGAAGTGCTTGGTGAGG MluI and NotI 
Ku70Mut6E1-R GCTCTATTGGAGGAGGTTCGAGAGCCTTCTGGACCAGATTATAAATGC − 
Ku70Mut6E2-F GGTCCAGAAGGCTCTCGAACCTCCTCCAATAGAGCTCTATCGG − 
Ku70Mut6E2-R GGAGGGATGTTCCTCTCGGGTGTGTATCTGCACAATGCTGC − 
Ku70Mut6E3-F GCAGATACACACCCGAGAGGAACATCCCTCCTTATTTTGTGGC − 
ID Sequence 5′ to 3′ Restriction sites 
FLAG-S GATCTGATTACAAGGATGACGACGATAAGCTCGAGGGCGGCCGCGGAA BglII, XhoI, NotI, and HindIII 
FLAG-AS AGCTTTCCGCGGCCGCCCTCGAGCTTATCGTCGTCATCCTTGTAATCA BglII, XhoI, NotI, and HindIII 
Ku70-F CCGCTCGAGTCAGGGTGGGAGTCATATTACAAAACC XhoI 
Ku70-R GGCGGATCCTTAGTCCTGGAAGTGCTTGGTGAGG BamHI 
Ku80-F GGCCTCGAGGTGCGGTCGGGGAATAAGG XhoI 
Ku80-R CGCGGATCCTATCATGTCCAATAAATCGTCCACATCACC BamHI 
XRCC4-F CCGCTCGAGGACTACAAGGACGATGACGACAAGGGATCC XhoI 
XRCC4-R GGCGAATTCTTAAATCTCATCAAAGAGGTCTTCTGG EcoRI 
AAVMCS-F CGCGCGGCCGCGCTAGCGAATTCGCAGCTGTTGTGCTGTGTATGG NotI, NheI, and EcoRI 
AAVMCS-R CGCGGGCCCACGCGTGGATCCCATCAACAGCATTCAACTGTGCC BamHI, MluI, and Bsp12OI 
Ku70-HA1-F CGCGCGGCCGCGAAGACTGCTTGGTGAATTCTGGAGTTCGG NotI 
Ku70-HA1-R GCCGCTAGCCATGTTGGCTACTGCTCACTAGGCG NheI 
Ku70-GFP-F GCCGCTAGCAAGGGCGAGGAGCTGTTCACCG NheI 
Ku70-GFP-R GGCACCGGTCTTATCGTCGTCATCCTTGTAATCAG AgeI 
Ku70-HA2-F CCGACCGGTTCAGGGTGGGAGTCATATTACAAAACC AgeI 
Ku70-HA2-R CCGACGCGTCAGTGAACCGAGATTGAGTCAGTGC MluI 
GFP-F GGCAAGCTTACCGGTCGCCACCATGGTGAGCAAGGGCG HindIII and AgeI 
GFP-R CCGCTCGAGCTTATCGTCGTCATCC XhoI 
Ku70siR-R GGCACGCGTGCGGCCGCTTAGTCCTGGAAGTGCTTGGTGAGG MluI and NotI 
Ku70Mut6E1-R GCTCTATTGGAGGAGGTTCGAGAGCCTTCTGGACCAGATTATAAATGC − 
Ku70Mut6E2-F GGTCCAGAAGGCTCTCGAACCTCCTCCAATAGAGCTCTATCGG − 
Ku70Mut6E2-R GGAGGGATGTTCCTCTCGGGTGTGTATCTGCACAATGCTGC − 
Ku70Mut6E3-F GCAGATACACACCCGAGAGGAACATCCCTCCTTATTTTGTGGC − 

Minus signs indicate that the oligonucleotide does not contain any restriction site used for cloning.

Close Modal

or Create an Account

Close Modal
Close Modal