Skip to Main Content
Table I.

Synthetic oligonucleotide primers used

Code
Sequence (5′ to 3′)
Underlined
 (nucleotide sequence at)
3F CCCAAGCTTATGCTGAGATCAATGTGGAAT 1–21 of rat PEX3 
3R CGCGGATCCTTTCTCCAGTTGTTGGGGGGT 1096–1116 of rat PEX3 
3(1–50)R CGCGGATCCGGCAATGTACTCTGCAGCTTC 130–150 of rat PEX3 
16HA2F GCTGGATCCATGGCGTACCCCTACGATGTGCCCGATTATGCATACCCCTACGATGTGCCCGATTATGCAATGGAGA
 AGCTGCGGCTCCTGGGC Tandem HA (tagging to human PEX16
16R GCTCTAGATCAGCCCCAACTGTAGAAGTA 991–1000 plus a stop codon of human PEX16 
11αHA2F GCTGGATCCATGGCGTACCCCTACGATGTGCCCGATTATGCATACCCCTACGATGTGCCCGATTATGCAATGGACG
 CCTTCACCCGCTTCACC Tandem HA (tagging to human PEX11α
11αR GCTCTAGACTAACGGGTCTTCAGCTTCAT 724–741 plus a stop codon of human PEX11α 
SSF CGGGGTACCGCCATGGGAGCTGCTGCAAAGTTGGCGTTCGCCGTCTTTCTTATCTCTTGCTCTTCAGGTGCTATACTTGGCAGATACCCATACGATGTTCCAGATTACGCTGGATCC
 ATGGCG Signal sequence of mouse activin type IIA receptor 
m16R GCTCAGCCATGTCAGCAGCTTCTGCTGGGACAGCGACAC
 TGGGAGTTTCTTTCTCAATTCTTTCCGTAGGATCCCGTCA
 TTGAG A silence mutation in human PEX16 
m16F AAGCTGCTGACATGGCTGAGCGTGCTGGAGTGCGTGGAAGTCTTTATGGAAATGGGCGCT A silence mutation in human PEX16 
Code
Sequence (5′ to 3′)
Underlined
 (nucleotide sequence at)
3F CCCAAGCTTATGCTGAGATCAATGTGGAAT 1–21 of rat PEX3 
3R CGCGGATCCTTTCTCCAGTTGTTGGGGGGT 1096–1116 of rat PEX3 
3(1–50)R CGCGGATCCGGCAATGTACTCTGCAGCTTC 130–150 of rat PEX3 
16HA2F GCTGGATCCATGGCGTACCCCTACGATGTGCCCGATTATGCATACCCCTACGATGTGCCCGATTATGCAATGGAGA
 AGCTGCGGCTCCTGGGC Tandem HA (tagging to human PEX16
16R GCTCTAGATCAGCCCCAACTGTAGAAGTA 991–1000 plus a stop codon of human PEX16 
11αHA2F GCTGGATCCATGGCGTACCCCTACGATGTGCCCGATTATGCATACCCCTACGATGTGCCCGATTATGCAATGGACG
 CCTTCACCCGCTTCACC Tandem HA (tagging to human PEX11α
11αR GCTCTAGACTAACGGGTCTTCAGCTTCAT 724–741 plus a stop codon of human PEX11α 
SSF CGGGGTACCGCCATGGGAGCTGCTGCAAAGTTGGCGTTCGCCGTCTTTCTTATCTCTTGCTCTTCAGGTGCTATACTTGGCAGATACCCATACGATGTTCCAGATTACGCTGGATCC
 ATGGCG Signal sequence of mouse activin type IIA receptor 
m16R GCTCAGCCATGTCAGCAGCTTCTGCTGGGACAGCGACAC
 TGGGAGTTTCTTTCTCAATTCTTTCCGTAGGATCCCGTCA
 TTGAG A silence mutation in human PEX16 
m16F AAGCTGCTGACATGGCTGAGCGTGCTGGAGTGCGTGGAAGTCTTTATGGAAATGGGCGCT A silence mutation in human PEX16 

F and R, forward and reverse primers, respectively.

Close Modal

or Create an Account

Close Modal
Close Modal