Normal alcohols (n-alcohols) can induce anesthetic effects by acting on neuronal ion channels. Recent studies have revealed the effects of n-alcohols on various ion channels; however, the underlying molecular mechanisms remain unclear. Here, we provide evidence that long-chain n-alcohols have dual effects on Kv7.2/7.3 channels, resulting in channel activation as the net effect. Using heterologous expression systems, we found that n-alcohols could differentially regulate the Kv7.2/7.3 channel depending on their chain length. Treatment with short-chain ethanol and propanol diminished Kv7.2/7.3 currents, whereas treatment with long-chain hexanol and octanol enhanced the currents. However, the long-chain alcohols failed to potentiate Kv7.2 currents pre-activated by retigabine. Instead, they inhibited the currents, similar to short-chain ethanol. The stimulatory effect of the long-chain n-alcohols was also converted into an inhibitory one in the mutant Kv7.2(W236L) channels, while the inhibitory effect of ethanol did not differ between wild-type Kv7.2 and mutant Kv7.2(W236L). The inhibition of currents by n-alcohols was also seen in Kv7.1 channel which does not have the tryptophan (W) residue in S5. These findings suggest that long-chain n-alcohols exhibit dual effects through independent working sites on the Kv7.2 channel. Finally, we confirmed that the hydroxyl group with a negative electrostatic potential surface is essential for the dual actions of n-alcohol. Together, our data suggest that long-chain n-alcohols regulate Kv7.2/7.3 channels by interacting with both stimulatory and inhibitory sites and that their stimulatory action depends on the conserved tryptophan 236 residue in S5 and could be important for triggering their anesthetic effects.
Introduction
Normal alcohols (n-alcohols), also known as primary alcohols, are organic psychoactive substances in which a hydroxyl group (-OH) binds to a primary carbon atom. They consist of short-chain (from one to five carbons, C1–C5) and long-chain (C6–C22) alcohols (Veenstra et al., 2009; Carignan et al., 2013; Ng et al., 2020). Previous studies have revealed that n-alcohols possess anesthetic activity in vivo (Alifimoff et al., 1989; Fang et al., 1997). However, the anesthetic mechanisms of n-alcohols are not fully understood. n-Alcohols have lipophilic properties; thus, they have traditionally been thought to act in a manner that disrupts the cell membrane in the central nervous system (Mullins, 1954; Seeman, 1972; Goldstein, 1984). More recent studies have revealed that alcohols change the ionic movement across the cell membrane by regulating the membrane proteins, including voltage-activated ion channels and ionotropic receptors, in the nervous system (Covarrubias et al., 1995; Dopico and Lovinger, 2009; Garcia et al., 2010; Howard et al., 2014). It has been confirmed that n-alcohols can inhibit sodium channels (Oxford and Swenson, 1979; Klein et al., 2007; Horishita and Harris, 2008), calcium channels (Eckle and Todorovic, 2010; McDavid et al., 2014), Shaw2 Kv channels (Covarrubias et al., 1995; Chu and Treistman, 1997; Shahidullah et al., 2003; Bhattacharji et al., 2010), and Shaker-type Kv channels (Martínez-Morales et al., 2015). In contrast, they can activate the large-conductance, calcium-activated potassium (BK) channels (Chu and Treistman, 1997; Bukiya et al., 2014), and the G protein-coupled inwardly rectifying potassium (GIRK) channels (Bodhinathan and Slesinger, 2013; Bodhinathan and Slesinger, 2014).
The Kv7 channel is a type of voltage-gated potassium channel that is broadly expressed in the central and peripheral nervous systems (Wang et al., 1998; Jentsch, 2000). Of the five members of Kv7 channels, Kv7.2 and Kv7.3 subunits form a stable Kv7.2/7.3 heteromeric channel complex that mediates the muscarine-sensitive M-current (Brown and Adams, 1980). The plasma membrane phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) is required for maintaining Kv7.2/7.3 channel activity as a cofactor; hence, the current is suppressed when PtdIns(4,5)P2 is depleted by Gq-coupled receptor activation (Suh and Hille, 2002; Suh and Hille, 2008; Falkenburger et al., 2010; Telezhkin et al., 2012). Kv7.2/7.3 channels begin to activate from around −40 mV and form non-inactivating currents at −20 mV with slow kinetics for current activation and deactivation in sympathetic ganglion cells (Brown and Adams, 1980; Wang et al., 1998; Brown and Passmore, 2009). Therefore, these channels have been considered to play an important role in determining the membrane potential and excitability of neurons (Greene and Hoshi, 2017).
The anesthetic potency of n-alcohols becomes stronger with an increase in the carbon number in the molecule, and this increase is observed until a cut-off is reached (Fang et al., 1997; Horishita and Harris, 2008; Eckle and Todorovic, 2010). Recently, the effect of n-alcohol was assessed in Kv7.2/7.3 channels using ethanol (EtOH), a short-chain n-alcohol (Kim et al., 2019). The authors reported that EtOH inhibited the M-type Kv7 channels in superior cervical ganglion (SCG) neurons and thus increased neuronal excitability by resetting the resting membrane potential. In the present study, we further assessed the effects of other short-chain and long-chain n-alcohols as well as the EtOH on Kv7.2/7.3 channels. Interestingly, unlike other ion channels showing consistent regulatory tendencies for n-alcohols, we found that Kv7.2/7.3 channels are differentially regulated by n-alcohols depending on their carbon chain length. We further revealed that at least two separate alcohol-binding sites, one for stimulatory effects and the other for inhibitory effects, seem to exist on the Kv7 channel and that the net effect of Kv7 channel stimulation contributes to the anesthetic effects of n-alcohols.
Materials and methods
Cell culture and transfection
TsA-201 cells were cultured in Dulbecco’s modified Eagle medium (DMEM; HyClone, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (HyClone, Thermo Fisher Scientific) and 0.2% penicillin/streptomycin (HyClone, Thermo Fisher Scientific) in 100-mm culture dishes at 37°C with 5% CO2. When the confluency of cells reached about 80%, they were subcultured using Dulbecco’s phosphate-buffered saline (DPBS; Gibco, Thermo Fisher Scientific) to detach the cells. Cells were cultured in 35-mm culture dishes according to the experimental schedule for transfection. For Kv7.2/7.3 channel expression, Kv7.2 (GenBank accession number AF110020) and Kv7.3 (GenBank accession number NM_004519) channels were transiently transfected at a 1:1 M ratio with 200 ng Ds-Red as a transfection marker. Kv7.1 (GenBank accession number NM_000218) which was cloned into the pCMV6-AC-GFP vector was kindly gifted by Dr. Seong Woo Choi (Dongguk University College of Medicine, Seoul, Korea). Lipofectamine 2000 (Invitrogen) was used for transfection when the confluency of cells reached 60–70% in a 35-mm culture dish. The transfected tsA-201 cells were plated onto coverslip chips coated with 0.1 mg/ml poly-L-lysine (Sigma-Aldrich) 36–48 h after transfection. Plated cells were studied in electrophysiological recording 12–24 h after plating.
Animals
Sprague-Dawley rats were purchased from SamTako Bio Korea. All animal procedures were approved by the Institutional Animal Care and Use Committee at Daegu Gyeongbuk Institute of Science and Technology (approval number: DGIST-IACUC-20042801-03). Carbon dioxide (CO2) inhalation was used for the anesthesia of rats. Neonates (5–7 d after birth) were used to prepare SCG.
SCG neuronal preparations
SCG neurons were cultured using the previously described protocol (Zareen and Greene, 2009). In brief, the isolated ganglia were placed in RPMI 1640 medium (Gibco, Thermo Fisher Scientific), treated with 0.25% trypsin, and incubated for 20 min at 37°C. Following the enzyme treatment, the ganglia were suspended in RPMI 1640 medium containing 10% heat-inactivated horse serum and 5% fetal bovine serum to stop digestion. Then, they were resuspended in RPMI 1640 medium containing 1% heat-inactivated horse serum, 100 ng/ml 2.5 S nerve growth factor, 0.4% penicillin/streptomycin, and 0.4% uridine/5-fluorodeoxyuridine. The cells were plated onto 0.1 mg/l poly-L-lysine with borate buffer chips at 37°C with 5% CO2. Plated neuronal cells were studied in electrophysiological recording within 2 d after plating.
Electrophysiological recording
TsA-201 cells were whole-cell clamped at room temperature (22–25°C) using a HEKA EPC-10 amplifier with Pulse software (HEKA Elektronik). The electrodes were pulled from glass micropipette capillaries using a P-97 micropipette puller (Sutter Instrument) that had a resistance of 2–5 MΩ. The whole-cell access resistance was 2–6 MΩ, and series-resistance errors were compensated by 60%. For recording Kv7 current, cells were held at −20 mV and applied a 500 ms hyperpolarizing step to −60 mV every 4 s. Kv7 currents of SCG neurons were measured in a whole-cell configuration. SCG neuronal cells were held at −20 mV, and a 500 ms hyperpolarizing step was applied to −55 mV every 4 s. Since various ion channels are expressed in SCG neurons, the change in current amplitude at −20 mV can reflect changes in other K+ currents as well as Kv7 currents. The Kv7 currents were indirectly obtained from deactivation current recorded at −55 mV as the difference between the average of a 10 ms segment (denoted as “Y0”), taken 10–20 ms into the hyperpolarizing step, and the average during the last 10 ms of that step (indicated as “Y1”). In all voltage protocols, the holding potential was −80 mV.
Solution and materials
The extracellular solution used for Kv7 current recording contained 160 mM NaCl, 2.5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, and 8 mM glucose, adjusted to pH 7.4 with NaOH. The intracellular solution of pipette consisted of 175 mM KCl, 5 mM MgCl2, 5 mM HEPES, 0.1 mM BAPTA, 3 mM Na2ATP, and 0.1 mM Na3GTP, adjusted to pH 7.2 with KOH. Retigabine (RTG) was purchased from Sigma-Aldrich. They were stored as 10 mM stocks in DMSO and diluted to working concentrations in extracellular solution on each experimental day. EtOH (purity [GC]: 99.9%) and BuOH (purity [GC]: 99.9%) were purchased from Merck, PrOH (purity [GC]: 99.99%), HeOH (purity [GC]: 99.6%), and OcOH (purity [GC]: 99.7%) used in this study were purchased from Sigma-Aldrich. n-Hexane solution (purity [GC]: 99.4%) and n-octane solution (purity [GC]: 99.4%) were purchased from Alfa Aesar and Merck, respectively. n-Hexane (about 7.65 M) and n-octane (about 6.15 M) were diluted to a working concentration of 10 and 1 mM using K+ Ringer’s solution, respectively. We performed a miscibility test and confirmed that the mixture was stable and homogenous without forming a meniscus in the diluted 10 mM n-hexane or 1 mM n-octane over a 24-h.
Molecular cloning
Single point mutation was introduced into Kv7.2 using the Quikchange II XL site-directed mutagenesis kit (Agilent Technologies). The mutation was verified by DNA sequencing (Macrogen). Primers for cloning were as follows, forward primer (5′→3′): GCTGGTCACTGCCTTGTACATCGGCTTCC and reverse primer (3′→5′): GGAAGCCGATGTACAAGGCAGTGACCAGC.
Data analysis and statistical analysis
All data were analyzed using Excel 2016 (Microsoft), IGOR Pro-6.34, and GraphPad Prism 7 (GraphPad Software). Statistics in text or figure were expressed as mean ± SEM. Statistical analysis for differences between the two groups was made by paired or unpaired Student’s t tests. One-way ANOVA was carried out to compare multiple groups. Depending on the variance and sample number, ANOVA was followed by Sidak’s, Games-Howell’s, Tukey’s, or Bonferroni post-hoc test. The time constants were measured by exponential fit. Data for normalized current-voltage (I-V) curves were fitted by the Boltzmann equation. For all analyses, P value < 0.05 was considered significant (*, P < 0.05; **, P < 0.01; and ***, P < 0.001).
Online supplemental material
Fig. S1 shows the consistent regulation of Kv7.2/7.3 channels by HeOH with different suppliers, grades, and purity. Fig. S2 shows the different modulation of Kv7.2 and Kv7.3 subtypes by OcOH. Fig. S3 shows the effect of HeOH on the activation and deactivation kinetics of Kv7 currents. Fig. S4 shows the insensitivity of mutant Kv7.2(W236L) channels to RTG. Figs. S5 and S6 show supporting data for Fig. 5. Fig. S7 shows the I-V relationship of mutant Kv7.2(W236L) channels insensitive to HeOH and OcOH. Fig. S8 shows the inhibition effect of EtOH on WT and mutant Kv7.2 channels independent of RTG. Fig. S9 shows the dual regulation of long-chain n-alcohols through two independent action sites without allosteric modulation. Fig. S10 shows the electrostatic potential (ESP) surface map of RTG and n-alcohols used in the experiment. Fig. S11 shows the effect of hexane and octane without negative ESP on WT Kv7.2, mutant Kv7.2(W236L) and Kv7.1 channels.
Results
Effect of n-alcohols on M-type Kv7 currents in cultured SCG neurons
To understand the anesthetic action of n-alcohols, we examined the regulatory effects of various types of n-alcohols on M-type Kv7 currents (IKv7) in primary cultured SCG neurons. Short-chain alcohols, such as EtOH, 1-propanol (PrOH), and 1-butanol (BuOH), and long-chain alcohols, such as 1-hexanol (HeOH) and 1-octanol (OcOH), were selected for the analysis (Fig. 1 A, top). Whole-cell patch recording was performed to measure the outward K+ currents while applying a depolarization voltage of −20 mV in SCG neurons. The IKv7 was calculated by subtracting the average current amplitude at 10 ms before the end of the tail current (Y1) from that at 5–10 ms after the peak of the current (Y0) and is denoted as IKv7(Y0-Y1) (Fig. 1 A). Time-course analysis revealed that IKv7(Y0-Y1) was inhibited by 31 ± 1% with 200 mM EtOH and by 27 ± 2% with 200 mM PrOH. On the other hand, treatment with 100 mM BuOH, 10 mM HeOH, and 1 mM OcOH resulted in the activation of Ikv7(Y0-Y1) by 2 ± 2, 48 ± 7, and 85 ± 6%, respectively (Fig. 1 C). RTG, the activator of Kv7, except for Kv7.1 (Schrøder et al., 2001; Tatulian et al., 2001; Lange et al., 2009), also enhanced Ikv7(Y0-Y1) in SCG neurons (Fig. 1 B). On using 1 μM of RTG, the concentration within the clinical concentration range (Stas et al., 2016), the Kv7 currents increased by 32 ± 6% (Fig. 1 C).
n-Alcohols and RTG regulate Kv7 currents in rat SCG neurons. (A) Top: The chemical structure of n-alcohols used in the present study. Bottom: Representative Kv7 current traces before (control) and after the application of 200 mM EtOH (blue), 200 mM PrOH (orange), 100 mM BuOH (red), 10 mM HeOH (purple), and 1 mM OcOH (green) in primary cultured SCG neurons. Inset shows the pulse protocol. The dashed line indicates 0 current. (B) Left: The chemical structure of RTG. Right: Representative Kv7 current traces before (control) and after the application of 1 μM RTG using the pulse protocol of −20 to −55 mV in an SCG neuron. (C) Percent activation of IKv7(Y0–Y1) after treatment with n-alcohols (EtOH, n = 12; PrOH, n = 10; BuOH, n = 11; HeOH, n = 5; and OcOH, n = 7) and RTG (n = 6) in primary cultured SCG neurons. Data are expressed as the mean ± SEM.
n-Alcohols and RTG regulate Kv7 currents in rat SCG neurons. (A) Top: The chemical structure of n-alcohols used in the present study. Bottom: Representative Kv7 current traces before (control) and after the application of 200 mM EtOH (blue), 200 mM PrOH (orange), 100 mM BuOH (red), 10 mM HeOH (purple), and 1 mM OcOH (green) in primary cultured SCG neurons. Inset shows the pulse protocol. The dashed line indicates 0 current. (B) Left: The chemical structure of RTG. Right: Representative Kv7 current traces before (control) and after the application of 1 μM RTG using the pulse protocol of −20 to −55 mV in an SCG neuron. (C) Percent activation of IKv7(Y0–Y1) after treatment with n-alcohols (EtOH, n = 12; PrOH, n = 10; BuOH, n = 11; HeOH, n = 5; and OcOH, n = 7) and RTG (n = 6) in primary cultured SCG neurons. Data are expressed as the mean ± SEM.
n-Alcohols differentially modulate heterologous Kv7.2/7.3 channels expressed in tsA-201 cells
To further examine how n-alcohols regulate Kv7 channels, the effects of n-alcohols were assessed in human embryonic kidney-derived tsA-201 cells transiently transfected with cDNAs encoding Kv7.2 and Kv7.3. Kv7.2/7.3 currents (IKv7.2/7.3) were obtained by applying a voltage of −20 mV. Four different concentrations of n-alcohols were sequentially treated for 40 s each (Fig. 2 A). The representative current traces before and after applying n-alcohols are shown in Fig. 2 B. The results revealed that treatment with 200 mM EtOH and 200 mM PrOH reduced IKv7.2/7.3 by 20 ± 2 and 1 ± 2%, respectively. On the other hand, treatment with 100 mM BuOH, 10 mM HeOH, and 1 mM OcOH enhanced the currents by 38 ± 5, 105 ± 7, and 77 ± 6%, respectively. Thus, IKv7.2/7.3 was diminished by EtOH but increased by BuOH, HeOH, and OcOH in a concentration-dependent manner (Fig. 2 C). These results were somewhat different from those obtained in SCG neurons. In the neuron, Ikv7(Y0-Y1) was strongly inhibited by PrOH; however, IKv7.2/7.3 in tsA-201 cells was not decreased significantly by PrOH. In contrast, BuOH had little effect on Ikv7(Y0-Y1) in SCG neurons, but it significantly increased IKv7.2/7.3 in tsA-201 cells.
n-Alcohols modulate Kv7.2/7.3 currents in a concentration-dependent manner, with the exception of PrOH. (A) Concentration-dependent regulation of Kv7.2/7.3 currents by n-alcohols. The currents were measured every 4 s at −20 mV in tsA-201 cells, and various concentrations of n-alcohols were applied for 40 s, as indicated. (B) Representative outward Kv7.2/7.3 currents before (control) and after the application of 200 mM EtOH (blue), 200 mM PrOH (orange), 100 mM BuOH (red), 10 mM HeOH (purple), and 1 mM OcOH (green) using the pulse protocol shown below. (C) Dose-response relationship of n-alcohols for Kv7.2/7.3 current regulation in tsA-201 cells. n = 4–6 for each point in EtOH (blue), n = 5–6 in PrOH (orange), n = 8–9 in BuOH (red), n = 5–10 in HeOH (purple), and n = 5–17 in OcOH (green). The percent activation was calculated from the current amplitude measured at −20 mV. Data are expressed as the mean ± SEM.
n-Alcohols modulate Kv7.2/7.3 currents in a concentration-dependent manner, with the exception of PrOH. (A) Concentration-dependent regulation of Kv7.2/7.3 currents by n-alcohols. The currents were measured every 4 s at −20 mV in tsA-201 cells, and various concentrations of n-alcohols were applied for 40 s, as indicated. (B) Representative outward Kv7.2/7.3 currents before (control) and after the application of 200 mM EtOH (blue), 200 mM PrOH (orange), 100 mM BuOH (red), 10 mM HeOH (purple), and 1 mM OcOH (green) using the pulse protocol shown below. (C) Dose-response relationship of n-alcohols for Kv7.2/7.3 current regulation in tsA-201 cells. n = 4–6 for each point in EtOH (blue), n = 5–6 in PrOH (orange), n = 8–9 in BuOH (red), n = 5–10 in HeOH (purple), and n = 5–17 in OcOH (green). The percent activation was calculated from the current amplitude measured at −20 mV. Data are expressed as the mean ± SEM.
Many Kv7 channel modulators function in a way that changes the voltage dependence of channel activation (Hou et al., 2019; Zhang et al., 2019; Li et al., 2021b). To further understand the effects of n-alcohols on voltage-dependent activation, we measured the I-V relationship of Kv7.2/7.3 channels before and after treatment with n-alcohols. Fig. 3 A shows the representative current traces elicited in response to test pulses from −70 to +40 mV in 10 mV increments. The overall current amplitudes decreased in the presence of EtOH, did not change in the presence of PrOH, and increased in the presence of BuOH, HeOH, and OcOH. The tail current amplitudes at −80 mV obtained from different voltages were normalized in cells before and after treatment with n-alcohols (Fig. 3 B). We found that 200 mM EtOH did not change the normalized I-V relationship of Kv7.2/7.3 channels (Fig. 3, B and C, top). The application of 200 mM PrOH resulted in a minor change in the I-V relationship. However, the application of 100 mM BuOH, 10 mM HeOH, and 1 mM OcOH shifted the activation curve of Kv7.2/7.3 channels to more negative ranges (Fig. 3, B and C). RTG (10 μM) had little effect on the maximal current amplitude (Li et al., 2021b); however, it induced a strong leftward shift in the I-V relationship (Fig. 3, B and C, bottom). Thus, the results of IKv7.2/7.3 elicited in tsA-201 cells indicated that BuOH, HeOH, and OcOH activated the channels by shifting the voltage sensitivity of Kv7.2/7.3 channels to the left, similar to RTG (Li et al., 2021b). On the other hand, EtOH reduced currents without changing the voltage sensitivity of Kv7 channels, while PrOH had no effect on the current amplitude but slightly shifted the voltage-dependent activation.
n-Alcohols and RTG shift the I-V relationship of Kv7.2/7.3 channels expressed in tsA-201 cells. (A) A family of representative outward currents in tsA-201 cells transfected with Kv7.2/7.3 channels. The cells were held at a holding potential of −80 mV, and depolarizing voltage steps were applied from −70 to +40 mV in 10 mV increments before (left) and after (right) the application of n-alcohols or RTG, as indicated. (B) Normalized tail current amplitudes at −80 mV were plotted against test potentials before (black) and after the addition of 200 mM EtOH (blue), 200 mM PrOH (orange), 100 mM BuOH (red), 10 mM HeOH (purple), 1 mM OcOH (green), and 10 μM RTG (magenta). (C) The half-maximal activation voltage (V1/2) values before (black) and after the addition of 200 mM EtOH (blue; n = 6; P = 0.06), 200 mM PrOH (orange; n = 6; P = 0.001), 200 mM BuOH (red; n = 6; P = 0.000009), 10 mM HeOH (purple; n = 5; P = 0.0001), 1 mM OcOH (green; n = 5; P = 0.0003), and 1 μM RTG (magenta; n = 5; P = 0.000007). Data are expressed as the mean ± SEM. Paired Student’s t test. **P < 0.01; ***P < 0.001.
n-Alcohols and RTG shift the I-V relationship of Kv7.2/7.3 channels expressed in tsA-201 cells. (A) A family of representative outward currents in tsA-201 cells transfected with Kv7.2/7.3 channels. The cells were held at a holding potential of −80 mV, and depolarizing voltage steps were applied from −70 to +40 mV in 10 mV increments before (left) and after (right) the application of n-alcohols or RTG, as indicated. (B) Normalized tail current amplitudes at −80 mV were plotted against test potentials before (black) and after the addition of 200 mM EtOH (blue), 200 mM PrOH (orange), 100 mM BuOH (red), 10 mM HeOH (purple), 1 mM OcOH (green), and 10 μM RTG (magenta). (C) The half-maximal activation voltage (V1/2) values before (black) and after the addition of 200 mM EtOH (blue; n = 6; P = 0.06), 200 mM PrOH (orange; n = 6; P = 0.001), 200 mM BuOH (red; n = 6; P = 0.000009), 10 mM HeOH (purple; n = 5; P = 0.0001), 1 mM OcOH (green; n = 5; P = 0.0003), and 1 μM RTG (magenta; n = 5; P = 0.000007). Data are expressed as the mean ± SEM. Paired Student’s t test. **P < 0.01; ***P < 0.001.
A long-chain HeOH modulates Kv7.2 and Kv7.3 channels differently
Among the n-alcohols used in the present study, HeOH activated both Ikv7 in SCG neurons and IKv7.2/7.3 in tsA-201 cells. We further investigated how HeOH increases Kv7.2/7.3 channel activity by examining the effects of HeOH on each subtype of Kv7 channels. First, we confirmed that the stimulatory effects of HeOH on current activation and I-V shift of Kv7.2/7.3 were consistent in products from three different commercial sources (Fig. S1), suggesting that the HeOH activity was not due to the chemical impurity or inconsistency in the purification of HeOH during manufacture. On treatment with 10 mM HeOH for 40 s, we observed that the effects differed depending on the Kv7 subtype (Fig. 4). HeOH strongly increased IKv7.2 at −20 mV (143 ± 14%); however, IKv7.3 was nearly insensitive to HeOH (5 ± 1%). HeOH had intermediate effects on Kv7.2/7.3 heteromeric channels (89 ± 6%; Fig. 4, A and B).
The effects observed with 1-HeOH is consistent in products from three different suppliers. (A) Comparison of Kv7.2/7.3 current increase after treatment with 10 mM HeOH obtained from three suppliers having different grades and purity (HeOH from Sigma-Aldrich: anhydrous, 99.6% purity, n = 5; HeOH from Supelco: analytical standard, 100% purity, n = 5; HeOH from Merck: synthesis, 98.5% purity, n = 5; not significant with P = 0.51). The percent activation was calculated from the current amplitude measured at −20 mV. (B) Normalized tail current amplitudes at −80 mV were plotted against test potential before and after the addition of 10 mM HeOH from different suppliers (Sigma-Aldrich, black, n = 6; Supelco, purple, n = 6; Merck, orange, n = 5). (C) Comparison of the change of half-maximal activation voltage (ΔV1/2) after application of 10 mM HeOH (Sigma-Aldrich, −15.6 ± 0.7 mV, n = 6; Supelco, −17.1 ± 0.5 mV, n = 6; Merck, −18.0 ± 0.7 mV, n = 5; P = 0.07). Data are expressed as the mean ± SEM. One-way ANOVA, followed by Tukey’s post-hoc test (A) and Bonferroni post-hoc test (C).
The effects observed with 1-HeOH is consistent in products from three different suppliers. (A) Comparison of Kv7.2/7.3 current increase after treatment with 10 mM HeOH obtained from three suppliers having different grades and purity (HeOH from Sigma-Aldrich: anhydrous, 99.6% purity, n = 5; HeOH from Supelco: analytical standard, 100% purity, n = 5; HeOH from Merck: synthesis, 98.5% purity, n = 5; not significant with P = 0.51). The percent activation was calculated from the current amplitude measured at −20 mV. (B) Normalized tail current amplitudes at −80 mV were plotted against test potential before and after the addition of 10 mM HeOH from different suppliers (Sigma-Aldrich, black, n = 6; Supelco, purple, n = 6; Merck, orange, n = 5). (C) Comparison of the change of half-maximal activation voltage (ΔV1/2) after application of 10 mM HeOH (Sigma-Aldrich, −15.6 ± 0.7 mV, n = 6; Supelco, −17.1 ± 0.5 mV, n = 6; Merck, −18.0 ± 0.7 mV, n = 5; P = 0.07). Data are expressed as the mean ± SEM. One-way ANOVA, followed by Tukey’s post-hoc test (A) and Bonferroni post-hoc test (C).
HeOH displays differential regulatory effects on Kv7 subtypes. (A) Top: Differential modulation of Kv7.2 (left), Kv7.2/7.3 (middle), and Kv7.3 (right) currents by HeOH. Kv7 currents were measured every 4 s at −20 mV, and 10 mM HeOH was applied for 40 s. (a and b) Bottom: Representative Kv7 current traces elicited in tsA-201 cells transfected with Kv7.2 and Kv7.3 either alone or in combination before (a) and after (b) the addition of HeOH using the protocol shown in the inset. (B) Percent activation of currents at −20 mV after treatment with 10 mM HeOH in Kv7.2 (n = 10), Kv7.2/7.3 (n = 5), and Kv7.3 (n = 8) channels (Kv7.2 vs. Kv7.2/7.3, P = 0.009; Kv7.2 vs. Kv7.3, P < 0.0001; Kv7.2/7.3 vs. Kv7.3, P = 0.0003). (C) Families of Kv7.2 (top), Kv7.2/7.3 (middle), and Kv7.3 (bottom) currents elicited by voltage steps applied from −70 to +40 mV in 10 mV increments. Representative current traces before (left) and after (right) the application of 10 mM HeOH, as indicated. (D) Normalized current amplitudes were plotted against test potentials before (control, black) and after (purple) the addition of 10 mM HeOH. (E) The half-maximal activation voltage (V1/2) values before (black) and after (purple) the addition of 10 mM HeOH (Kv7.2, n = 6; P = 0.0002; Kv7.2/7.3, n = 6; P = 0.000004; Kv7.3, n = 6; P = 0.000006). Data are expressed as the mean ± SEM. One-way ANOVA, followed by Games–Howell’s post-hoc test (B) and paired Student’s t test (E). **P < 0.01; ***P < 0.001.
HeOH displays differential regulatory effects on Kv7 subtypes. (A) Top: Differential modulation of Kv7.2 (left), Kv7.2/7.3 (middle), and Kv7.3 (right) currents by HeOH. Kv7 currents were measured every 4 s at −20 mV, and 10 mM HeOH was applied for 40 s. (a and b) Bottom: Representative Kv7 current traces elicited in tsA-201 cells transfected with Kv7.2 and Kv7.3 either alone or in combination before (a) and after (b) the addition of HeOH using the protocol shown in the inset. (B) Percent activation of currents at −20 mV after treatment with 10 mM HeOH in Kv7.2 (n = 10), Kv7.2/7.3 (n = 5), and Kv7.3 (n = 8) channels (Kv7.2 vs. Kv7.2/7.3, P = 0.009; Kv7.2 vs. Kv7.3, P < 0.0001; Kv7.2/7.3 vs. Kv7.3, P = 0.0003). (C) Families of Kv7.2 (top), Kv7.2/7.3 (middle), and Kv7.3 (bottom) currents elicited by voltage steps applied from −70 to +40 mV in 10 mV increments. Representative current traces before (left) and after (right) the application of 10 mM HeOH, as indicated. (D) Normalized current amplitudes were plotted against test potentials before (control, black) and after (purple) the addition of 10 mM HeOH. (E) The half-maximal activation voltage (V1/2) values before (black) and after (purple) the addition of 10 mM HeOH (Kv7.2, n = 6; P = 0.0002; Kv7.2/7.3, n = 6; P = 0.000004; Kv7.3, n = 6; P = 0.000006). Data are expressed as the mean ± SEM. One-way ANOVA, followed by Games–Howell’s post-hoc test (B) and paired Student’s t test (E). **P < 0.01; ***P < 0.001.
The I-V relationships were also assessed to understand the effect of HeOH on the voltage dependence of channel activation. TsA-201 cells overexpressing Kv7.2, Kv7.3, or both exhibited outward potassium currents in response to test pulses from −70 to +40 mV in 10 mV increments. Representative current traces before and after HeOH treatment are shown in Fig. 4 C. HeOH increased the maximal current amplitudes of Kv7.2 homomeric and Kv7.2/7.3 heteromeric channels; however, the Kv7.3 homomeric channel currents showed no significant change. Unlike the differences in representative current traces among subtypes, the normalized I-V relationship was left-shifted by HeOH in IKv7.2, IKv7.3, and IKv7.2/7.3 (Fig. 4 D). In tsA-201 cells, the half-maximal activation voltage (V1/2) commonly changed after the application of HeOH in cells expressing Kv7.2, Kv7.2/7.3, and Kv7.3 channels (Fig. 4 E). We also verified that OcOH modulates Kv7 channels with the same tendency as HeOH (Fig. S2).
OcOH modulates differentially Kv7.2 and Kv7.3 subtypes. (A) Top: Differential modulation of Kv7.2 (left), Kv7.2/7.3 (middle), and Kv7.3 (right) currents by 1 mM OcOH. The Kv7 currents were measured every 4 s at −20 mV and 1 mM OcOH were applied for 40 s. (a and b) Bottom: Representative Kv7 current traces elicited in tsA-201 cells transfected with Kv7.2 and Kv7.3 either individually or in combination before (a) and after the addition of OcOH (b) using the protocol of −20 to −60 mV. (B) Percent activation of currents after treatment with 1 mM octanol in Kv7.2 (n = 6), Kv7.2/7.3 (n = 6) and Kv7.3 (n = 5; Kv7.2 vs. Kv7.2/7.3, P = 0.12; Kv7.2 vs. Kv7.3, P = 0.001; Kv7.2/7.3 vs. Kv7.3, P = 0.0008). (C) Families of Kv7.2 (top) and Kv7.3 (bottom) currents elicited by voltage steps applied from −70 to +40 mV in 10 mV increments. Representative current traces before (left) and after (right) the application of 1 mM OcOH, as indicated. (D) Normalized current amplitudes were plotted against test potentials before (control, black) and after (green) treatment of 1 mM OcOH. (E) The half-maximal activation voltage (V1/2) values before (black) and after (green) the addition of 1 mM OcOH (Kv7.2, n = 6; P = 0.0008; Kv7.3, n = 7; P = 0.00002). Data are expressed as the mean ± SEM. One-way ANOVA followed by Games-Howell’s post-hoc test (B) and paired Student’s t test (E). **P < 0.01; ***P < 0.001.
OcOH modulates differentially Kv7.2 and Kv7.3 subtypes. (A) Top: Differential modulation of Kv7.2 (left), Kv7.2/7.3 (middle), and Kv7.3 (right) currents by 1 mM OcOH. The Kv7 currents were measured every 4 s at −20 mV and 1 mM OcOH were applied for 40 s. (a and b) Bottom: Representative Kv7 current traces elicited in tsA-201 cells transfected with Kv7.2 and Kv7.3 either individually or in combination before (a) and after the addition of OcOH (b) using the protocol of −20 to −60 mV. (B) Percent activation of currents after treatment with 1 mM octanol in Kv7.2 (n = 6), Kv7.2/7.3 (n = 6) and Kv7.3 (n = 5; Kv7.2 vs. Kv7.2/7.3, P = 0.12; Kv7.2 vs. Kv7.3, P = 0.001; Kv7.2/7.3 vs. Kv7.3, P = 0.0008). (C) Families of Kv7.2 (top) and Kv7.3 (bottom) currents elicited by voltage steps applied from −70 to +40 mV in 10 mV increments. Representative current traces before (left) and after (right) the application of 1 mM OcOH, as indicated. (D) Normalized current amplitudes were plotted against test potentials before (control, black) and after (green) treatment of 1 mM OcOH. (E) The half-maximal activation voltage (V1/2) values before (black) and after (green) the addition of 1 mM OcOH (Kv7.2, n = 6; P = 0.0008; Kv7.3, n = 7; P = 0.00002). Data are expressed as the mean ± SEM. One-way ANOVA followed by Games-Howell’s post-hoc test (B) and paired Student’s t test (E). **P < 0.01; ***P < 0.001.
When HeOH was applied to tsA-201 cells expressing Kv7.3 channels, the current amplitude hardly changed at −20 mV, while the deactivating current at −60 mV dramatically slowed down (Fig. 4 A, right). As RTG has been reported to have a marked effect on IKv7 kinetics (Main et al., 2000), we next assessed the effects of HeOH on the kinetics of Kv7 channel activation and deactivation. The representative activation and deactivation traces obtained from tsA-201 cells expressing Kv7.2, heteromeric Kv7.2/7.3, and Kv7.3 channels in the absence or presence of 10 mM HeOH are shown in Fig. S3, A and B. Kv7.2 and Kv7.2/7.3 channels were normally deactivated when applying a voltage step of −60 mV, whereas Kv7.3 channels were not fully deactivated in the presence of HeOH. Thus, a resting potential of −70 mV was used for the activation and deactivation of Kv7.3 channels. In both Kv7.2/7.3 and Kv7.3 channels, treatment with HeOH accelerated the current activation rate and slowed down the deactivation kinetics (Fig. S3 C). In the case of Kv7.2 channels, the activation was mildly accelerated by 10 mM HeOH, while the deactivation was not significantly affected (Fig. S3 C). These results support that HeOH regulates IKv7 kinetics, accelerating the rate of channel activation; however, it slows down deactivation kinetics in a subtype-specific manner.
Effects of HeOH on activation and deactivation kinetics of Kv7 currents. Activation and deactivation of Kv7.2, Kv7.2/7.3, and Kv7.3 currents were assessed in the presence of 10 mM HeOH using the voltage protocol shown below. For the Kv7.2 and Kv7.2/7.3, a protocol of −60 mV was used, and for Kv7.3, a protocol of −70 mV was used. (A) Activation current traces; Kv7.2 (top), Kv7.2/7.3 (middle), and Kv7.3 (bottom). (B) Deactivation current traces; Kv7.2 (top), Kv7.2/7.3 (middle), and Kv7.3 (bottom). (C) Both activation and deactivation of Kv7 currents were fitted with a single exponential function. The time constants from the fittings are shown; Kv7.2 (activation under control condition was 114 ± 4 and 76 ± 5 ms in the presence of hexanol, n = 5 each, P = 0.0003 and deactivation was 38 ± 4 ms under the control conditions and 38 ± 5 ms in the presence of hexanol, n = 5 each, P = 0.67; top), Kv7.2/7.3 (activation was 146 ± 6 ms under the control condition and for hexanol was 42 ± 2 ms, n = 9 each, P = 0.0000002 and deactivation under the control was 46 ± 2 ms and hexanol was 64 ± 3 ms, n = 9 each, P = 0.00008; middle), and Kv7.3 (activation: under the control was 108 ± 5 ms and hexanol was 31 ± 2 ms, n = 7 each, P = 0.00002 and deactivation for control was 55 ± 4 ms and hexanol was 84 ± 5 ms, n = 7 each, P = 0.04; bottom). Data are expressed as the mean ± SEM. Paired Student’s t test. *P < 0.05; ***P < 0.001.
Effects of HeOH on activation and deactivation kinetics of Kv7 currents. Activation and deactivation of Kv7.2, Kv7.2/7.3, and Kv7.3 currents were assessed in the presence of 10 mM HeOH using the voltage protocol shown below. For the Kv7.2 and Kv7.2/7.3, a protocol of −60 mV was used, and for Kv7.3, a protocol of −70 mV was used. (A) Activation current traces; Kv7.2 (top), Kv7.2/7.3 (middle), and Kv7.3 (bottom). (B) Deactivation current traces; Kv7.2 (top), Kv7.2/7.3 (middle), and Kv7.3 (bottom). (C) Both activation and deactivation of Kv7 currents were fitted with a single exponential function. The time constants from the fittings are shown; Kv7.2 (activation under control condition was 114 ± 4 and 76 ± 5 ms in the presence of hexanol, n = 5 each, P = 0.0003 and deactivation was 38 ± 4 ms under the control conditions and 38 ± 5 ms in the presence of hexanol, n = 5 each, P = 0.67; top), Kv7.2/7.3 (activation was 146 ± 6 ms under the control condition and for hexanol was 42 ± 2 ms, n = 9 each, P = 0.0000002 and deactivation under the control was 46 ± 2 ms and hexanol was 64 ± 3 ms, n = 9 each, P = 0.00008; middle), and Kv7.3 (activation: under the control was 108 ± 5 ms and hexanol was 31 ± 2 ms, n = 7 each, P = 0.00002 and deactivation for control was 55 ± 4 ms and hexanol was 84 ± 5 ms, n = 7 each, P = 0.04; bottom). Data are expressed as the mean ± SEM. Paired Student’s t test. *P < 0.05; ***P < 0.001.
Tryptophan 236 residue is critical for Kv7.2 activation by long-chain n-alcohols
Although not identical, the stimulatory effects of HeOH were reminiscent of RTG, an M-type Kv7 channel activator. Therefore, we used the Kv7.2 homomeric channel to confirm whether n-alcohols can interact with a key residue that is important for the action of RTG. RTG interacts with multiple residues in the Kv7.2 channel (Shi et al., 2020; Li et al., 2021b). Of these, the tryptophan residue W236 is the most essential one. When W236 was substituted with leucine, the Kv7.2(W236L) channels became insensitive to RTG (Schenzer et al., 2005; Wuttke et al., 2005).
All Kv7 channels share a topological design, and four subunits come together to form a single channel, with each subunit consisting of six transmembrane segments (S1–S6; Manville and Abbott, 2018a). Among these, W236 is located in S5 of the Kv7.2 channel. We created a W236L mutant by replacing this residue with leucine (Fig. S4 A). Then, we assessed the current amplitude-dependent activation (I/Icontrol) at −20 mV to confirm whether the mutant Kv7.2(W236L) channel became insensitive to RTG. The WT Kv7.2 channel was activated by 1, 10, and 30 μM RTG; however, the mutant Kv7.2(W236L) channel was insensitive to all the RTG concentrations (Fig. S4 B).
The W236L mutant is insensitive to RTG. (A) Topology of Kv7.2 channel showing W236, a residue essential for action of RTG, in the S5 segment. Figure created with BioRender.com. (B) Dose-response curve of RTG effects on outward current of WT Kv7.2 (circle) and mutant Kv7.2(W236L) channels (square) at −20 mV, where the ratio of current amplitude in the presence of RTG (I) versus that in the absence of RTG (Icontrol) was plotted against 1, 10, and 30 μM RTG. (WT Kv7.2, n = 7–10; mutant Kv7.2(W236L), n = 6–12). Data are expressed as the mean ± SEM.
The W236L mutant is insensitive to RTG. (A) Topology of Kv7.2 channel showing W236, a residue essential for action of RTG, in the S5 segment. Figure created with BioRender.com. (B) Dose-response curve of RTG effects on outward current of WT Kv7.2 (circle) and mutant Kv7.2(W236L) channels (square) at −20 mV, where the ratio of current amplitude in the presence of RTG (I) versus that in the absence of RTG (Icontrol) was plotted against 1, 10, and 30 μM RTG. (WT Kv7.2, n = 7–10; mutant Kv7.2(W236L), n = 6–12). Data are expressed as the mean ± SEM.
To examine whether long-chain n-alcohols can activate Kv7.2 channels through W236, the WT Kv7.2 and mutant Kv7.2(W236L) channels were treated with RTG and HeOH. First, the concentration-response curves for RTG and HeOH were determined in WT Kv7.2 channels (Fig. S5). When tsA-201 cells expressing WT Kv7.2 channels were treated with 30 μM RTG, the current amplitude at −20 mV was activated by 86 ± 7%. However, the current amplitude was hardly activated further by 10 mM HeOH in the presence of RTG (Fig. 5, A and B). However, the stimulatory activity of HeOH still appeared in cells pretreated with lower concentrations of RTG (Fig. 5 B). Mutant Kv7.2(W236L) currents were insensitive to 30 μM RTG, while treatment with 10 mM HeOH in the presence of 30 μM RTG induced a significant decrease in the current amplitude (Fig. 5, C and D). As the data could not rule out the possibility that the order of application could affect the results, the compounds were treated in reverse order. Our results showed that the current activation by the second RTG was suppressed by the first HeOH treatment in a dose-dependent manner; HeOH more than 3 mM almost completely inhibited the subsequent current activation by 10 μM RTG (Fig. 5, E and F). Interestingly, when tsA-201 cells expressing the mutant Kv7.2(W236L) channel were treated with HeOH, the current amplitude at −20 mV did not increase; instead, it diminished by 35 ± 6% after treatment of 10 mM HeOH. Treatment with 10 μM RTG in the presence of HeOH did not affect the current amplitude (Fig. 5, G and F). We further assessed the I-V relationship of Kv7.2 channels before and after treatment with 30 μM RTG with or without 10 mM HeOH (Fig. S6 A). Each tail current amplitude at −80 mV obtained from different voltages was normalized (Fig. S6 B). Treatment with 30 μM RTG alone and with 30 μM RTG with 10 mM HeOH shifted the I-V relationship to the left, with no significant difference being noted between the degree of changes in V1/2 (P = 0.25; Fig. S6 C). Together, these results suggested that the stimulatory effects of HeOH were mediated by left-shifting the I-V curve through interaction with the tryptophan 236 residue in S5, similar to RTG.
Concentration-response curve of hexanol and RTG for percent activation of WT Kv7.2 currents in tsA-201 cells. Percent activation of Kv7.2 current amplitudes by 0.1, 1, 3, and 10 mM HeOH (n = 5−10 for each point, purple) and 0.1, 1, 3, 10, and 30 µM RTG (n = 5−9 for each point, magenta) were measured at −20 mV. Data are expressed as the mean ± SEM.
Concentration-response curve of hexanol and RTG for percent activation of WT Kv7.2 currents in tsA-201 cells. Percent activation of Kv7.2 current amplitudes by 0.1, 1, 3, and 10 mM HeOH (n = 5−10 for each point, purple) and 0.1, 1, 3, 10, and 30 µM RTG (n = 5−9 for each point, magenta) were measured at −20 mV. Data are expressed as the mean ± SEM.
The stimulatory action of HeOH depends on the conserved tryptophan 236 residue. (A) Top: The modulatory effects of RTG and HeOH on wild-type Kv7.2 currents were assessed at −20 mV in tsA-201 cells. Cells were stimulated with 30 μM RTG alone and in combination with 10 mM HeOH. (a–c) Bottom: Representative Kv7.2 current traces before (a) and during the application of 30 μM RTG (b) and after the addition of 10 mM HeOH in the presence of RTG (c) in tsA-201 cells. (B) Summary of Kv7.2 current regulation in the indicated conditions (1 μM RTG and 10 mM HeOH, n = 7, P = 0.06; 10 μM RTG and 10 mM HeOH, n = 9, P = 0.000008; 30 μM RTG and 10 mM HeOH, n = 7, P = 0.00001). (C) Top: The modulatory effects of RTG and HeOH on mutant Kv7.2(W236L) currents were measured. (a′–c′) Bottom: Representative traces of elicited W236L currents before (a′) and during the application of 30 μM RTG (b′) and after the addition of 10 mM HeOH in the presence of RTG (c′). (D) Summary of W236L current regulation in the indicated conditions (10 μM RTG and 10 mM HeOH, n = 5, P = 0.46; 30 μM RTG and 10 mM HeOH, n = 6, P = 0.009). (E) Top: Time-dependent regulation of WT Kv7.2 channels was assessed at −20 mV in tsA-201 cells. Cells were stimulated with 10 mM HeOH alone and further treated with 10 μM RTG in the presence of HeOH. (d–f) Bottom: Representative traces of Kv7.2 currents before (d) and during the application of 10 mM HeOH (e) and after the addition of 10 μM RTG in the presence of HeOH (f). (F) Summary of Kv7.2 current regulation in the indicated conditions (1 mM HeOH and 10 μM RTG, n = 5, P = 0.08; 3 mM HeOH and 10 μM RTG, n = 5, P = 0.0002; 10 mM HeOH and 10 μM RTG, n = 7, P = 0.0002). (G) Top: Time-dependent regulation of W236L channels by HeOH and RTG was assessed. (d′–f′) Bottom: Representative traces of W236L currents before (d′) and during the application of 10 mM HeOH (e′) and after the addition of 10 μM RTG in the presence of HeOH (f′). (H) Summary of W236L current regulation in the indicated conditions (3 mM HeOH and 10 μM RTG, n = 6, P = 0.0009; 10 mM HeOH and 10 μM RTG, n = 5, P = 0.008). Data are expressed as the mean ± SEM. Paired Student’s t test. **P < 0.01; ***P < 0.001.
The stimulatory action of HeOH depends on the conserved tryptophan 236 residue. (A) Top: The modulatory effects of RTG and HeOH on wild-type Kv7.2 currents were assessed at −20 mV in tsA-201 cells. Cells were stimulated with 30 μM RTG alone and in combination with 10 mM HeOH. (a–c) Bottom: Representative Kv7.2 current traces before (a) and during the application of 30 μM RTG (b) and after the addition of 10 mM HeOH in the presence of RTG (c) in tsA-201 cells. (B) Summary of Kv7.2 current regulation in the indicated conditions (1 μM RTG and 10 mM HeOH, n = 7, P = 0.06; 10 μM RTG and 10 mM HeOH, n = 9, P = 0.000008; 30 μM RTG and 10 mM HeOH, n = 7, P = 0.00001). (C) Top: The modulatory effects of RTG and HeOH on mutant Kv7.2(W236L) currents were measured. (a′–c′) Bottom: Representative traces of elicited W236L currents before (a′) and during the application of 30 μM RTG (b′) and after the addition of 10 mM HeOH in the presence of RTG (c′). (D) Summary of W236L current regulation in the indicated conditions (10 μM RTG and 10 mM HeOH, n = 5, P = 0.46; 30 μM RTG and 10 mM HeOH, n = 6, P = 0.009). (E) Top: Time-dependent regulation of WT Kv7.2 channels was assessed at −20 mV in tsA-201 cells. Cells were stimulated with 10 mM HeOH alone and further treated with 10 μM RTG in the presence of HeOH. (d–f) Bottom: Representative traces of Kv7.2 currents before (d) and during the application of 10 mM HeOH (e) and after the addition of 10 μM RTG in the presence of HeOH (f). (F) Summary of Kv7.2 current regulation in the indicated conditions (1 mM HeOH and 10 μM RTG, n = 5, P = 0.08; 3 mM HeOH and 10 μM RTG, n = 5, P = 0.0002; 10 mM HeOH and 10 μM RTG, n = 7, P = 0.0002). (G) Top: Time-dependent regulation of W236L channels by HeOH and RTG was assessed. (d′–f′) Bottom: Representative traces of W236L currents before (d′) and during the application of 10 mM HeOH (e′) and after the addition of 10 μM RTG in the presence of HeOH (f′). (H) Summary of W236L current regulation in the indicated conditions (3 mM HeOH and 10 μM RTG, n = 6, P = 0.0009; 10 mM HeOH and 10 μM RTG, n = 5, P = 0.008). Data are expressed as the mean ± SEM. Paired Student’s t test. **P < 0.01; ***P < 0.001.
RTG inhibits hexanol-induced modulation of Kv7.2 currents. (A) Kv7.2 currents were recorded before (control) and after the addition of 30 μM RTG alone (+RTG) or RTG plus 10 mM hexanol (+RTG + HeOH) using a voltage protocol from −70 to +40 mV in 10 mV increments (B) Normalized current amplitudes were plotted against test potentials before (black) and after the addition of RTG (grey) or RTG plus hexanol (purple). (C) The change of half-maximal activation voltage (ΔV1/2) value after addition of 30 μM RTG (grey) or 30 μM RTG plus 10 mM hexanol (purple; ΔV1/2 of RTG: −31 ± 2 mV, n = 5 and ΔV1/2 of RTG with hexanol: −28 ± 2 mV, n = 6; P = 0.25). Data are expressed as the mean ± SEM. Student’s t test.
RTG inhibits hexanol-induced modulation of Kv7.2 currents. (A) Kv7.2 currents were recorded before (control) and after the addition of 30 μM RTG alone (+RTG) or RTG plus 10 mM hexanol (+RTG + HeOH) using a voltage protocol from −70 to +40 mV in 10 mV increments (B) Normalized current amplitudes were plotted against test potentials before (black) and after the addition of RTG (grey) or RTG plus hexanol (purple). (C) The change of half-maximal activation voltage (ΔV1/2) value after addition of 30 μM RTG (grey) or 30 μM RTG plus 10 mM hexanol (purple; ΔV1/2 of RTG: −31 ± 2 mV, n = 5 and ΔV1/2 of RTG with hexanol: −28 ± 2 mV, n = 6; P = 0.25). Data are expressed as the mean ± SEM. Student’s t test.
We also measured the I-V relationship of W236L channels before and after treatment with HeOH or OcOH to confirm how long-chain n-alcohols modulate V1/2 on mutant Kv7.2(W236L) channels. The overall current amplitudes decreased in the presence of HeOH or OcOH in W236L channels (Fig. S7 A). The tail current amplitudes at −80 mV obtained from different voltages were normalized in cells before and after treatment with HeOH or OcOH (Fig. S7 B). We found that 10 mM HeOH or 1 mM OcOH did not change the normalized I-V relationship of W236L channels (Fig. S7 C). These results indicate that the voltage-dependency of the current as well as the activation of current amplitude by long-chain n-alcohols were abolished in mutant W236L channels.
Long-chain n-alcohols do not affect the I-V relationship of mutant Kv7.2(W236L) channels expressed in tsA-201 cells. (A) A family of representative outward currents in tsA-201 cells transfected with W236L channels. The cells were held at a holding potential of −80 mV, and depolarizing voltage steps were applied from −70 to +40 mV in 10 mV increments before (left) and after (right) the application of HeOH or OcOH. (B) Normalized tail current amplitudes were plotted against test potentials before (black) and after the application of 10 mM HeOH (purple) or 1 mM OcOH (green). (C) The half-maximal activation voltage (V1/2) values before (black) and after the addition of 10 mM HeOH (purple; n = 5; P = 0.27) or 1 mM OcOH (green; n = 5; P = 0.57). Data are expressed as the mean ± SEM. Paired Student’s t test.
Long-chain n-alcohols do not affect the I-V relationship of mutant Kv7.2(W236L) channels expressed in tsA-201 cells. (A) A family of representative outward currents in tsA-201 cells transfected with W236L channels. The cells were held at a holding potential of −80 mV, and depolarizing voltage steps were applied from −70 to +40 mV in 10 mV increments before (left) and after (right) the application of HeOH or OcOH. (B) Normalized tail current amplitudes were plotted against test potentials before (black) and after the application of 10 mM HeOH (purple) or 1 mM OcOH (green). (C) The half-maximal activation voltage (V1/2) values before (black) and after the addition of 10 mM HeOH (purple; n = 5; P = 0.27) or 1 mM OcOH (green; n = 5; P = 0.57). Data are expressed as the mean ± SEM. Paired Student’s t test.
Next, we assessed whether the W236 residue is also essential for the inhibitory activity of EtOH. When tsA-201 cells expressing WT Kv7.2 channels were treated with 200 mM EtOH, the amplitude of the currents at −20 mV diminished by 26 ± 2%. WT Kv7.2 currents were activated by 77 ± 13% after treatment with 30 μM RTG, while treatment with 200 mM EtOH in the presence of RTG diminished the currents by 32 ± 4% (Fig. S8, A and C). Mutant Kv7.2(W236L) currents were diminished by 29 ± 1% by 200 mM EtOH; however, they were insensitive to 30 μM RTG (Fig. S8, B and C). The application of 200 mM EtOH in the presence of RTG diminished the currents by 32 ± 3%. No significant differences were noted between the WT Kv7.2 and mutant Kv7.2(W236L) channels in terms of current reduction by EtOH in the absence or presence of RTG (Fig. S8 C). These results indicated that the inhibitory activity of EtOH was independent of W236 in S5.
Inhibition of Kv7.2 currents by EtOH is independent of RTG binding site. (A) Top: The modulatory effects of RTG and EtOH on wild-type Kv7.2 currents were measured at −20 mV in tsA-201 cells. Cells were treated with 200 mM EtOH in the absence or presence of 30 μM RTG. Bottom: Representative Kv7.2 current traces at the indicated time points. (B) Top: The modulatory effects of RTG and EtOH on mutant Kv7.2(W236L) currents were measured at −20 mV in tsA-201 cells. Cells were treated with 200 mM EtOH in the absence or presence of 30 μM RTG. Bottom: Representative mutant Kv7.2(W236L) current traces at the indicated time points. (C) Summary of Kv7 current regulation (RTG: n = 7 in WT and n = 8 in W236L; EtOH: n = 5 in WT and n = 6 in W236L; RTG + EtOH: n = 6 in WT and n = 6 in W236L). WT (EtOH) vs. W236L (EtOH), P = 0.92; WT (EtOH) vs. WT (RTG + EtOH), P = 0.5; WT (EtOH) vs. W236L (RTG + EtOH), P = 0.61; W236L (EtOH) vs. WT (RTG + EtOH), P = 0.98; W236L (EtOH) vs. W236L (RTG + EtOH), P > 0.99; WT (RTG + EtOH) vs. W236L (RTG + EtOH), P > 0.99. Data are expressed as the mean ± SEM. One-way ANOVA followed by Sidak’s post-hoc test.
Inhibition of Kv7.2 currents by EtOH is independent of RTG binding site. (A) Top: The modulatory effects of RTG and EtOH on wild-type Kv7.2 currents were measured at −20 mV in tsA-201 cells. Cells were treated with 200 mM EtOH in the absence or presence of 30 μM RTG. Bottom: Representative Kv7.2 current traces at the indicated time points. (B) Top: The modulatory effects of RTG and EtOH on mutant Kv7.2(W236L) currents were measured at −20 mV in tsA-201 cells. Cells were treated with 200 mM EtOH in the absence or presence of 30 μM RTG. Bottom: Representative mutant Kv7.2(W236L) current traces at the indicated time points. (C) Summary of Kv7 current regulation (RTG: n = 7 in WT and n = 8 in W236L; EtOH: n = 5 in WT and n = 6 in W236L; RTG + EtOH: n = 6 in WT and n = 6 in W236L). WT (EtOH) vs. W236L (EtOH), P = 0.92; WT (EtOH) vs. WT (RTG + EtOH), P = 0.5; WT (EtOH) vs. W236L (RTG + EtOH), P = 0.61; W236L (EtOH) vs. WT (RTG + EtOH), P = 0.98; W236L (EtOH) vs. W236L (RTG + EtOH), P > 0.99; WT (RTG + EtOH) vs. W236L (RTG + EtOH), P > 0.99. Data are expressed as the mean ± SEM. One-way ANOVA followed by Sidak’s post-hoc test.
The functional significant of tryptophan residue in S5 was further examined using Kv7.1 channel in which the S5 tryptophan is innately occupied by a leucine residue (Fig. 6 A). As reported previously (Schenzer et al., 2005), Kv7.1 channel was insensitive to RTG (Fig. 6 B). Similar to Kv7.2/7.3 channels, EtOH inhibited Kv7.1 currents at −20 mV. The long-chain n-alcohols, HeOH and OcOH also reduced the Kv7.1 currents (Fig. 6, B and C). To further identify the effects of n-alcohols on voltage-dependent activation, we measured the I-V relationship of Kv7.1 tail currents at −40 mV before and after treatment with n-alcohols. Fig. 6 D showed the representative current traces elicited in response to test pulses from −80 to +60 mV in 10 mV increments. The overall current amplitudes decreased (Fig. 6 D) and the tail current density at −40 mV was diminished by EtOH, HeOH, and OcOH without shift in the I-V relationships (Fig. 6 E).
Both short- and long-chain n-alcohols inhibit Kv7.1 currents. (A) Alignment of S5 forming amino acids from the Kv7 channels. Red box, the residue that is not conserved in Kv7.1. (B) Top: Time-course of Kv7.1 currents upon treatment of 200 mM EtOH, 3 mM HeOH, 0.3 mM OcOH, and 1 µM RTG for 40 s each. Bottom: Representative traces showed Kv7.1 currents in the presence of EtOH (blue), HeOH (purple), OcOH (green), and RTG (magenta). (C) Percent inhibition of Kv7.1 currents at −20 mV after treatment with EtOH (n = 7), HeOH (n = 6), OcOH (n = 6), and RTG (n = 5). (D) Current traces of the same tsA-201 cells expressing Kv7.1 before (left) and after treatment of EtOH, HeOH, and OcOH (right). The voltage protocol is shown in the inset. (E) Tail current density recorded at −40 mV before and after treatment of EtOH (top, n = 5; from −20 to +60 mV, P < 0.01), HeOH (middle, n = 5; at −30 mV, P = 0.01 and from −20 to +60 mV, P < 0.001), and OcOH (bottom, n = 5; at −40 mV, P = 0.03 and from −30 to +60 mV, P < 0.01). Data are expressed as the mean ± SEM. Paired Student’s t test. *P < 0.05, **P < 0.01, ***P < 0.001.
Both short- and long-chain n-alcohols inhibit Kv7.1 currents. (A) Alignment of S5 forming amino acids from the Kv7 channels. Red box, the residue that is not conserved in Kv7.1. (B) Top: Time-course of Kv7.1 currents upon treatment of 200 mM EtOH, 3 mM HeOH, 0.3 mM OcOH, and 1 µM RTG for 40 s each. Bottom: Representative traces showed Kv7.1 currents in the presence of EtOH (blue), HeOH (purple), OcOH (green), and RTG (magenta). (C) Percent inhibition of Kv7.1 currents at −20 mV after treatment with EtOH (n = 7), HeOH (n = 6), OcOH (n = 6), and RTG (n = 5). (D) Current traces of the same tsA-201 cells expressing Kv7.1 before (left) and after treatment of EtOH, HeOH, and OcOH (right). The voltage protocol is shown in the inset. (E) Tail current density recorded at −40 mV before and after treatment of EtOH (top, n = 5; from −20 to +60 mV, P < 0.01), HeOH (middle, n = 5; at −30 mV, P = 0.01 and from −20 to +60 mV, P < 0.001), and OcOH (bottom, n = 5; at −40 mV, P = 0.03 and from −30 to +60 mV, P < 0.01). Data are expressed as the mean ± SEM. Paired Student’s t test. *P < 0.05, **P < 0.01, ***P < 0.001.
To confirm the effect of other n-alcohols, WT Kv7.2 and mutant Kv7.2(W236L) channels were treated with EtOH, PrOH, HeOH, or OcOH. Consistent with the early results, EtOH, PrOH, HeOH, and OcOH differentially regulated the WT Kv7.2 currents (Fig. 7, A and C). In mutant Kv7.2(W236L) channels, the currents were diminished similarly by EtOH, PrOH, HeOH, and OcOH (Fig. 7, B and C). These results suggested the presence of an inhibitory binding site that was independent of the W236 residues and had a similar binding affinity to several types of n-alcohols. In contrast, the conserved tryptophan residue in S5 may mediate the stimulatory effect of long-chain n-alcohols. We thus designed a potential model for studying the effect of n-alcohols on the Kv7 channel (Fig. 7 D).
Identifying the putative working sites of n-alcohols using wild-type Kv7.2 and mutant Kv7.2(W236L) subunits. (A) Top: The modulatory effects of n-alcohols on wild-type Kv7.2 currents in tsA-201 cells. (a–h) Bottom: Kv7.2 current traces before (a, c, e, and g) and during (b, d, f, and h) the application of n-alcohols using the pulse protocol of −20 to −60 mV. (B) Top: The modulatory effects of n-alcohols on mutant Kv7.2(W236L) currents in tsA-201 cells. (a′–h′) Bottom: Mutant Kv7.2(W236L) current traces before (a′, c′, e′, and g′) and during (b′, d′, f′, and h′) the application of n-alcohols using the pulse protocol of −20 to −60 mV. (C) Summary of current regulation by n-alcohols (200 mM EtOH, n = 7 and 9, P = 0.9; 200 mM PrOH, n = 7 and 6, P = 0.004; 10 mM HeOH, n = 10 and 8, P = 0.00000003; 1 mM OcOH, n = 6 and 5, P = 0.00003). (D) Topological representation of Kv7 channels showing two out of four subunits. S4–5L, S4–S5 loop. Red, conserved tryptophan residue in S5. VSD, voltage-sensing domain. PD, pore domain. Figure created with BioRender.com. Data are expressed as the mean ± SEM. Student’s t test. **P < 0.01; ***P < 0.001.
Identifying the putative working sites of n-alcohols using wild-type Kv7.2 and mutant Kv7.2(W236L) subunits. (A) Top: The modulatory effects of n-alcohols on wild-type Kv7.2 currents in tsA-201 cells. (a–h) Bottom: Kv7.2 current traces before (a, c, e, and g) and during (b, d, f, and h) the application of n-alcohols using the pulse protocol of −20 to −60 mV. (B) Top: The modulatory effects of n-alcohols on mutant Kv7.2(W236L) currents in tsA-201 cells. (a′–h′) Bottom: Mutant Kv7.2(W236L) current traces before (a′, c′, e′, and g′) and during (b′, d′, f′, and h′) the application of n-alcohols using the pulse protocol of −20 to −60 mV. (C) Summary of current regulation by n-alcohols (200 mM EtOH, n = 7 and 9, P = 0.9; 200 mM PrOH, n = 7 and 6, P = 0.004; 10 mM HeOH, n = 10 and 8, P = 0.00000003; 1 mM OcOH, n = 6 and 5, P = 0.00003). (D) Topological representation of Kv7 channels showing two out of four subunits. S4–5L, S4–S5 loop. Red, conserved tryptophan residue in S5. VSD, voltage-sensing domain. PD, pore domain. Figure created with BioRender.com. Data are expressed as the mean ± SEM. Student’s t test. **P < 0.01; ***P < 0.001.
To further understand the relationship between the stimulatory and inhibitory sites for n-alcohols in Kv7 channels, the effects of EtOH and HeOH were measured in WT Kv7.2 and mutant Kv7.2(W236L) channels in the absence or presence of the activator RTG (Fig. S9). First, the inhibition of Kv7.2 currents (IKv7.2) by EtOH was compared in conditions without and with RTG (Fig. S9, A and B). There was no significant difference in percent inhibition of currents by each concentration of EtOH between the two conditions, suggesting that even the stimulatory tryptophan 236 residue was occupied by RTG, the inhibitory effect of EtOH on Kv7.2 channels was not changed. We also verified whether the effects of n-alcohols could be changed by the substitution of tryptophan 236 of the Kv7.2 channel to leucine. As shown in Fig. S9, C and D, since there was no difference in percent inhibition by EtOH between the WT and W236L channels, the inhibitory action by EtOH was not affected by the W236L mutation in Kv7.2 channels. Finally, when the stimulatory and inhibitory effects of HeOH were normalized each other, there was no difference between the two response curves (Fig. S9, E and F). Together, the results suggest that no allosteric modulation exists between the two regulatory sites.
Dual regulation of Kv7 channels by long-chain n-alcohols occurs through two independent action sites without allosteric modulation. (A) Concentration-response curves for treatment of EtOH alone and EtOH in the presence of RTG in WT Kv7.2 channels. (B) Percent inhibition of Kv7.2 currents after treatment with EtOH alone (n = 5−8) and EtOH in the presence of RTG (n = 5−6). EtOH 1 mM (P = 0.75), 30 mM (P = 0.42), 100 mM (P = 0.11), and 300 mM (P = 0.52). (C) Concentration-response curves for treatment of EtOH in WT Kv7.2 and mutant Kv7.2(W236L) channels. (D) Percent inhibition of WT Kv7.2 (n = 5−8) and W236L currents (n = 5−8) after treatment with EtOH. EtOH 1 mM (P = 0.86), 30 mM (P = 0.53), 100 mM (P = 0.97), and 300 mM (P = 0.70). (E) Concentration-response curves for treatment of HeOH in WT Kv7.2 (n = 5−10) and mutant Kv7.2(W236L) channels (n = 5−8). (F) Percent activation in WT and inhibition in W236L were normalized to each value at 0.1 mM HeOH. Data are expressed as the mean ± SEM. Student’s t test.
Dual regulation of Kv7 channels by long-chain n-alcohols occurs through two independent action sites without allosteric modulation. (A) Concentration-response curves for treatment of EtOH alone and EtOH in the presence of RTG in WT Kv7.2 channels. (B) Percent inhibition of Kv7.2 currents after treatment with EtOH alone (n = 5−8) and EtOH in the presence of RTG (n = 5−6). EtOH 1 mM (P = 0.75), 30 mM (P = 0.42), 100 mM (P = 0.11), and 300 mM (P = 0.52). (C) Concentration-response curves for treatment of EtOH in WT Kv7.2 and mutant Kv7.2(W236L) channels. (D) Percent inhibition of WT Kv7.2 (n = 5−8) and W236L currents (n = 5−8) after treatment with EtOH. EtOH 1 mM (P = 0.86), 30 mM (P = 0.53), 100 mM (P = 0.97), and 300 mM (P = 0.70). (E) Concentration-response curves for treatment of HeOH in WT Kv7.2 (n = 5−10) and mutant Kv7.2(W236L) channels (n = 5−8). (F) Percent activation in WT and inhibition in W236L were normalized to each value at 0.1 mM HeOH. Data are expressed as the mean ± SEM. Student’s t test.
The hydroxyl group (-OH) is essential for the modulation of n-alcohols
Recent studies have revealed that RTG possesses a negative ESP surface near its carbonyl groups; this ESP is essential for the activation of Kv7.2/7.3 channels (Kim et al., 2015; Shi et al., 2020). We found that the hydroxyl group of n-alcohols has a negative ESP (Fig. S10). To assess whether the hydroxyl group of n-alcohols is also crucial for the modulation of Kv7.2/7.3 channels, we used hexane and octane with the same carbon number as HeOH and OcOH but without any hydroxyl group (Fig. 8, A and G). On treating tsA-201 cells expressing Kv7.2/7.3 channels with 10 mM hexane or 1 mM octane for 40 s, there was no significant change in the current amplitude at −20 mV (Fig. 8, B, C, H, and I). In addition, there were no changes in the I-V relationship and V1/2 values of Kv7.2/7.3 channels (Fig. 8, D–F and J–L). Similarly, the application of hexane and octane did not affect WT Kv7.2 and mutant Kv7.2(W236L) currents (Fig. S11, A–D). Moreover, the neutral forms did not show the inhibitory effects on Kv7.1 channel (Fig. S11, E and F). This result suggests that the hydroxyl group is required for both stimulatory and inhibitory effects of n-alcohols on Kv7 channels. On the other hand, 3-hexanol with the same number of carbon and hydroxyl group as HeOH but with a different hydroxyl group position, where the negative ESP was located in the middle rather than the end (Fig. 8 M), exhibited only the inhibitory action on Kv7.2/7.3 channels (Fig. 8, N and O), suggesting that position of the ESP surface near the hydroxyl group within the molecule is also important in the regulatory actions of n-alcohols.
Structures and ESP surface. Structures and ESP surfaces of n-alcohols and RTG as indicated. ESP was plotted using Avogadro. Red, negative; blue, positive; grey, neutral. Arrows indicated hydroxyl group in n-alcohols or carbonyl oxygen in RTG.
A hydroxyl group is essential for the action of n-alcohols. (A) ESP surface and chemical structure of n-hexane. (B) Left: The effect of 10 mM hexane on Kv7.2/7.3 currents elicited at −20 mV in tsA-201 cells. The currents were measured every 4 s, and hexane was applied for 40 s. (a and b) Right: Representative outward Kv7.2/7.3 currents before (a) and after (b) the application of 10 mM hexane using the pulse protocol of −20 to −60 mV. (C) Summary of the effects of hexane on Kv7.2/7.3 currents (n = 9, P = 0.15). (D) Family of Kv7.2/7.3 currents elicited by voltage steps from −70 to +40 mV in 10 mV increments. Representative current traces before (left) and after (right) the application of 10 mM hexane. (E) Normalized current amplitudes were plotted against test potentials before (black) and after (purple) the application of 10 mM hexane. (F) The half-maximal activation voltage (V1/2) values before (control) and after the addition of 10 mM hexane (n = 5; P = 0.53). (G) ESP and chemical structure of n-octane. (H) Left: The effect of 1 mM octane on Kv7.2/7.3 currents. (a and b) Right: Representative outward Kv7.2/7.3 currents before (a) and after (b) the treatment of 1 mM octane. (I) Summary of the effects of octane on Kv7.2/7.3 currents (n = 6, P = 0.12). (J) Representative current traces before (left) and after (right) the application of 1 mM octane. (K) Normalized current amplitudes were plotted against test potentials before (black) and after (green) the application of 1 mM octane. (L) V1/2 values before (control) and after the addition of 1 mM octane (n = 6; P = 0.3). (M) ESP and chemical structure of 3-HeOH. (N) Left: Time-course of Kv7.2/7.3 currents upon treatment of 10 mM 3-HeOH for 40 s. (a and b) Right: Representative traces showing Kv7.2/7.3 currents before (a) and after (b) treatment of 10 mM 3-HeOH. (O) Summary of the effects of 3-HeOH on Kv7.2/7.3 currents (n = 5, P = 0.01). Data are expressed as the mean ± SEM. Paired Student’s t test. *P < 0.05.
A hydroxyl group is essential for the action of n-alcohols. (A) ESP surface and chemical structure of n-hexane. (B) Left: The effect of 10 mM hexane on Kv7.2/7.3 currents elicited at −20 mV in tsA-201 cells. The currents were measured every 4 s, and hexane was applied for 40 s. (a and b) Right: Representative outward Kv7.2/7.3 currents before (a) and after (b) the application of 10 mM hexane using the pulse protocol of −20 to −60 mV. (C) Summary of the effects of hexane on Kv7.2/7.3 currents (n = 9, P = 0.15). (D) Family of Kv7.2/7.3 currents elicited by voltage steps from −70 to +40 mV in 10 mV increments. Representative current traces before (left) and after (right) the application of 10 mM hexane. (E) Normalized current amplitudes were plotted against test potentials before (black) and after (purple) the application of 10 mM hexane. (F) The half-maximal activation voltage (V1/2) values before (control) and after the addition of 10 mM hexane (n = 5; P = 0.53). (G) ESP and chemical structure of n-octane. (H) Left: The effect of 1 mM octane on Kv7.2/7.3 currents. (a and b) Right: Representative outward Kv7.2/7.3 currents before (a) and after (b) the treatment of 1 mM octane. (I) Summary of the effects of octane on Kv7.2/7.3 currents (n = 6, P = 0.12). (J) Representative current traces before (left) and after (right) the application of 1 mM octane. (K) Normalized current amplitudes were plotted against test potentials before (black) and after (green) the application of 1 mM octane. (L) V1/2 values before (control) and after the addition of 1 mM octane (n = 6; P = 0.3). (M) ESP and chemical structure of 3-HeOH. (N) Left: Time-course of Kv7.2/7.3 currents upon treatment of 10 mM 3-HeOH for 40 s. (a and b) Right: Representative traces showing Kv7.2/7.3 currents before (a) and after (b) treatment of 10 mM 3-HeOH. (O) Summary of the effects of 3-HeOH on Kv7.2/7.3 currents (n = 5, P = 0.01). Data are expressed as the mean ± SEM. Paired Student’s t test. *P < 0.05.
Hexane and octane have no effects on wild-type Kv7.2, W236L mutant, and Kv7.1 channels. (A) Top: The effect of 10 mM hexane on Kv7.2 (left) or mutant Kv7.2(W236L) currents (right) in tsA-201 cells. The currents were measured every 4 s and hexane was applied for 40 s. (a–d) Bottom: Representative Kv7.2 and Kv7.2(W236L) currents in control (a and c) and after application of 10 mM hexane (b and d) using the pulse protocol of −20 to −60 mV. (B) Summary of the effects of hexane on WT Kv7.2 (n = 5, P = 0.18) and W236L mutant (n = 5, P = 0.94). (C) Top: The effect of 1 mM octane on Kv7.2 (left) or W236L currents (right). Bottom: Representative Kv7.2 and W236L currents in control (a and c) and after application of 1 mM octane (b and d). (D) Summary of the effects of octane on WT Kv7.2 (n = 5, P = 0.22) and W236L mutant (n = 6, P = 0.79). (E) Top: The effect of 10 mM hexane (left) or 1 mM octane (right) on Kv7.1 currents. Bottom: Representative Kv7.1 currents in control (a and c) and after treatment of 10 mM hexane (b) or 1 mM octane (d). (F) Summary of the effects of hexane (n = 6, P = 0.17) and octane (n = 6, P = 0.17) on Kv7.1. Data are expressed as the mean ± SEM. Paired Student’s t test.
Hexane and octane have no effects on wild-type Kv7.2, W236L mutant, and Kv7.1 channels. (A) Top: The effect of 10 mM hexane on Kv7.2 (left) or mutant Kv7.2(W236L) currents (right) in tsA-201 cells. The currents were measured every 4 s and hexane was applied for 40 s. (a–d) Bottom: Representative Kv7.2 and Kv7.2(W236L) currents in control (a and c) and after application of 10 mM hexane (b and d) using the pulse protocol of −20 to −60 mV. (B) Summary of the effects of hexane on WT Kv7.2 (n = 5, P = 0.18) and W236L mutant (n = 5, P = 0.94). (C) Top: The effect of 1 mM octane on Kv7.2 (left) or W236L currents (right). Bottom: Representative Kv7.2 and W236L currents in control (a and c) and after application of 1 mM octane (b and d). (D) Summary of the effects of octane on WT Kv7.2 (n = 5, P = 0.22) and W236L mutant (n = 6, P = 0.79). (E) Top: The effect of 10 mM hexane (left) or 1 mM octane (right) on Kv7.1 currents. Bottom: Representative Kv7.1 currents in control (a and c) and after treatment of 10 mM hexane (b) or 1 mM octane (d). (F) Summary of the effects of hexane (n = 6, P = 0.17) and octane (n = 6, P = 0.17) on Kv7.1. Data are expressed as the mean ± SEM. Paired Student’s t test.
Discussion
In the present study, we found that n-alcohols could differentially regulate IKv7.2/7.3 depending on their carbon chain length in SCG neurons. Short-chain n-alcohols, such as EtOH and PrOH, decreased the current amplitude, whereas long-chain n-alcohols, such as HeOH and OcOH, increased the current amplitude. In addition, the longer the carbon chains, the stronger was the potentiation of current amplitudes. We further confirmed that long-chain n-alcohols could shift the voltage dependency of IKv7.2/7.3 to more hyperpolarized voltages in tsA-201 cells in a Kv7 subtype-specific manner. Through experiments on mutant Kv7.2(W236L) and Kv7.1 channels with EtOH, HeOH, and RTG, we found that the stimulatory effects of n-alcohols are mediated by a conserved tryptophan residue in S5, while the inhibitory effects of n-alcohols seem to be coupled with the selective EtOH-binding site. Finally, we identified that the essential element of long-chain n-alcohols for Kv7 channel regulation is the hydroxyl head group with a negative ESP. As Kv7.2/7.3 channels play an important role in regulating the resting membrane potential and excitability of SCG neurons (Kim et al., 2019), the present results suggest that long-chain n-alcohols contribute to the anesthetic effects by making it harder to depolarize the membrane and action potentials firing through the net activation of Kv7 channels.
We observed some differences in the regulatory effects of n-alcohols between tsA-201 cells and SCG neurons. This may be due to a couple of cellular properties. The first difference is membrane phospholipid dynamics. Ptdlns(4,5)P2 is a fundamental signaling cofactor of many ion channels (Hille et al., 2015). It is located in the inner leaflet of plasma membrane and required for many membrane proteins to function as a cofactor. Thus, when the PtdIns(4,5)P2 is hydrolyzed by phospholipase C (PLC), Kv7 channels are turned off in SCG neurons (Brown and Adams, 1980; Suh and Hille, 2002; Zhang et al., 2003; Winks et al., 2005). According to the previous studies, the resynthesis rate of PtdIns(4,5)P2 and PtdIns(4)P, a PtdIns(4,5)P2 precursor, after degradation is much faster in SCG neurons than in tsA-201 cells (Kruse et al., 2016; Kruse and Whitten, 2021). This may cause the difference in the phospholipid composition of the plasma membrane and in the diffusion permeability of n-alcohols through the plasma membrane. The second is ion channel phenotypes expressed in the cells. In our study, tsA-201 cells exhibited outward potassium currents at −20 mV mostly due to overexpression of Kv7.2 and Kv7.3. On the other hand, SCG neurons endogenously express various ion channels, such as TTX-sensitive voltage-gated sodium channels (Rush et al., 2006; Liu et al., 2012), Kv2 channels (Liu and Bean, 2014), and CaV2.2 channels (Cheng et al., 2018), as well as Kv7.2 and Kv7.3 (Wang et al., 1998). Although the effects of n-alcohols on those channels are elusive, we speculated that nonspecific regulation of the diverse ion channels by n-alcohols may contribute to the difference in the sensitivity between tsA-201 cells and SCG neurons.
We found that HeOH induces changes in the kinetics of Kv7.2/7.3 channel gating. Although there were differences among subtypes, treatment with HeOH accelerated the current activation rate and slowed down the current deactivation rate. On the other hand, we found that EtOH inhibits IKv7.2/7.3 without shifting the channel activation curve. Recent studies by our group have revealed that EtOH suppresses the current by reducing PtdIns(4,5)P2 sensitivity and the open probability of Kv7.2/7.3 channels instead of controlling a single current or channel number (Kim et al., 2019; Kim and Suh, 2021). Moreover, previous studies have reported that RTG activates Kv7.2/7.3 channels through an increase in open probability (Tatulian and Brown, 2003; Syeda et al., 2016). Therefore, further studies are needed to confirm whether n-alcohols modulate Kv7.2/7.3 channels through the regulation of PtdIns(4,5)P2 sensitivity and open probability.
In the present study, we found that the chain length of n-alcohols is a crucial factor for Kv7.2/7.3 channel regulation. n-Alcohols consist of a hydrophilic hydroxyl group and hydrophobic carbon chains. As n-alcohols have a single hydroxyl group, their hydrophobicity depends on their chain length (McKarns et al., 1997). EtOH, a short-chain alcohol, has relatively lower hydrophobicity and molar volume (Rottiers et al., 2016); therefore, it can easily pass through the cell membrane and be located on the intracellular side (Patra et al., 2006). On the other hand, long-chain alcohols have high hydrophobicity and are more likely to interact with residues located on the lipid bilayer. Thus, the difference between the polarity and hydrophobicity of n-alcohols leads to different results. Nicotinic acetylcholine receptors have been reported to have at least two separate loci for alcohol actions (Wood et al., 1991). Each site has different chain length requirements—one for activation by short-chain alcohols and the other for inhibition by long-chain alcohols. The present results suggested the possibility that long-chain n-alcohols can bind to two separate working sites on a single Kv7.2/7.3 channel and differently regulate channel gating without allosteric modulation between the sites.
RTG is a neuronal Kv7 channel activator that interacts with several residues in the Kv7 channel. Of these, the conserved tryptophan residue in S5 is the most critical site for activating channel gating (Li et al, 2021b, 2021a). The conserved tryptophan 236 residue in S5 is also a crucial residue for other reported Kv7 activators, such as BMS-204352 (Schrøder et al., 2001; Dupuis et al., 2002; Korsgaard et al., 2005), acrylamide (S)-1 (Bentzen et al., 2006; Jepps et al., 2014), and ML213 (Jepps et al., 2014; Kim et al., 2015). RTG was withdrawn from the market in 2017 because of its low specificity among subtypes, which resulted in several side effects, such as skin discoloration, blurred vision, and urinary retention (French et al., 2011; Brickel et al., 2012), in addition to declined use; however, it is still used for research purposes. In the present study, we found that the mutation of the RTG-binding site in Kv7.2 channels to W236L blocked the activation by HeOH as well as RTG, suggesting that long-chain n-alcohols activate Kv7 channels through the activation mechanism of RTG. This was further confirmed by examining the effects of n-alcohols in Kv7.1 channel which does not have the RTG-binding tryptophan residue in S5. However, it did not change the inhibitory effects of EtOH and HeOH, suggesting that n-alcohols inhibit Kv7 channels through a mechanism independent of the RTG-binding site. Based on research on different potassium channels and EtOH-binding sites (Shahidullah et al., 2003; Bodhinathan and Slesinger, 2014; Bukiya et al., 2014), it may be inferred that the EtOH working site of the Kv7 channel is located in the cytosolic domain. Therefore, the stimulatory and inhibitory sites of n-alcohols are separated in Kv7 channels.
Our results demonstrate that the hydroxyl group (-OH) and its negative ESP is the functional moiety of n-alcohols. The neutral hexane and octane forms showed no activation of Kv7.2/7.3 channels and no inhibition of mutant Kv7.2(W236L) channels, suggesting that the negative ESP is essential for both stimulatory and inhibitory actions of long-chain n-alcohols. Several previous studies also showed that the negative ESP is essential for the regulatory effects of diverse compounds on Kv7 channels. For example, the negative ESP near the carbonyl oxygen moiety was essential for activation of Kv7.2/7.3 channels by a synthetic anticonvulsant, ML-213 (Kim et al., 2015), while it played an important role in the activation of Kv7.2/7.3 channels by glutaconic acid and isovaleric acid (Manville and Abbott, 2018b). Compounds consisting only of hydrocarbons, such as 1-heptene, did not carry negative ESP and did not affect Kv7.2/7.3 currents (Manville and Abbott, 2018b). Since the short-chain n-alcohols without -OH exists as a gas at room temperature, therefore, we could not test the ESP effects of short forms on the currents.
Further research is required to examine whether the changes in IKv7.2/7.3 caused by n-alcohols affect action potential generation in neurons and lead to anesthesia in animals. Approximately 10% inhibition of sodium current was found to decrease the propagation of action potential and neural firings (Scholz et al., 1998; Scholz and Vogel, 2000; Horishita and Harris, 2008). On the other hand, ∼25% reduction of M-type Kv7 channel activity by a single mutation led to an abnormal increase in neuronal excitability (Schroeder et al., 1998). However, how much change in Kv7 currents suppresses neuronal firing and induces anesthesia remains unclear. Nevertheless, IKv7 was activated by 48 ± 7 and 85 ± 6% on treatment with 10 mM HeOH and 1 mM OcOH, respectively, in SCG neurons. This finding suggests the possibility that long-chain n-alcohols could lead to anesthesia by damping the resting membrane potential and action potential firing. Based on the present results and previous results on sodium channels (Oxford and Swenson, 1979; Klein et al., 2007; Horishita and Harris, 2008), it can be concluded that EtOH and PrOH majorly decrease the propagation of action potentials through sodium channel inhibition, whereas BuOH and other long-chain alcohols induce anesthetic effects through both sodium channel inhibition and Kv7 channel activation.
In summary, the present results suggest that two separate sites interact with n-alcohols: a stimulatory site in the S5 domain and an inhibitory site probably on the intracellular side of the Kv7.2/7.3 channel. Kv7.2/7.3 channels are differently regulated depending on the chain length of n-alcohols. Long-chain n-alcohols have dual effects on separate sites, with the net effect being channel activation. n-Alcohols have been found to have anesthetic properties even before nitrous oxide and diethyl ether were used (Nuland, 1984). However, the molecular mechanism underlying the anesthetic effects remained unclear. The present study demonstrated that long-chain n-alcohols with the negative ESP at position 1 carbon may induce anesthetic effects by increasing Kv7.2/7.3 channel gating through interactions with the conserved stimulatory site tryptophan residue in the S5 domain.
Acknowledgments
Jeanne M. Nerbonne served as editor.
We thank many laboratories for providing the plasmids.
This work was supported by the National Research Foundation of Korea (NRF) grants funded by the Korean Government Ministry of Sciences and ICT (No. 2022R1A2C100656011 and No. 2020R1A4A1019436).
The authors declare no competing financial interests.
Author contributions: D.J. Jeong and B.C. Suh designed the research; D.J. Jeong and K.W. Kim performed the biochemical and electrophysiological experiments; D.J. Jeong and B.C. Suh wrote the paper; B.C. Suh supervised the project.
