Interleukin 12 (IL-12) is a 70-kD proinflammatory cytokine produced by antigen presenting cells that is essential for the induction of T helper type 1 development. It comprises 35-kD (p35) and 40-kD (p40) polypeptides encoded by separate genes that are induced by a range of stimuli that include lipopolysaccharide (LPS), DNA, and CD40 ligand. To date, the regulation of IL-12 expression at the transcriptional level has mainly been examined in macrophages and restricted almost exclusively to the p40 gene. Here we show that in CD8+ dendritic cells, major producers of IL-12 p70, the Rel/nuclear factor (NF)-κB signaling pathway is necessary for the induction of IL-12 in response to microbial stimuli. In contrast to macrophages which require c-Rel for p40 transcription, in CD8+ dendritic cells, the induced expression of p35 rather than p40 by inactivated Staphylococcus aureus, DNA, or LPS is c-Rel dependent and regulated directly by c-Rel complexes binding to the p35 promoter. This data establishes the IL-12 p35 gene as a new target of c-Rel and shows that the regulation of IL-12 p70 expression at the transcriptional level by Rel/NF-κB is controlled through both the p35 and p40 genes in a cell type–specific fashion.

Introduction

IL-12 is a disulfide-linked 70-kD heterodimer composed of 35-kD (p35) and 40-kD (p40) subunits, each of which is encoded by a distinct gene 1. IL-12 p70 is important in the immune response to microorganisms and tumors, activating NK cells and T lymphocytes, which in turn initiates IFN-γ production and antigen-specific Th1 responses 1,2,3. Its role in promoting inflammation has also led to IL-12 being implicated in immunopathology associated with allergy and autoimmune diseases 1.

Although many different APCs produce IL-12 1, dendritic cells (DCs) have emerged as major producers of this cytokine both in culture and in vivo in response to stimuli of a microbial origin, or a T cell–derived signal such as CD40 ligand 4,5,6,7. The regulation of IL-12 production is complex, with evidence for the control of p35 and p40 expression at the transcriptional, posttranscriptional, and posttranslational levels 1. To date, the regulation of IL-12 expression has largely focused on p40. This is largely the result of early findings that showed the induction of IL-12 coincided with an upregulation of p40 mRNA levels, while p35 gene expression was generally ubiquitous 1. Recent evidence, however, suggests that attributing the induced expression of IL-12 solely to an increase in p40 expression is an oversimplification. First, the level of p35 mRNA is rapidly elevated in monocytes and DCs by the same agents that induce p40 expression and IL-12 production 8,9. Second, p40 is frequently produced in excess as a monomer or a homodimer (p40)2 1,10,11. As p40 homodimers bind to the IL-12 receptor and antagonize IL-12–mediated immune function 12, the biological activity of IL-12 may be determined in part by the ratio of p70 to (p40)2, which in turn would indicate that p35 levels are likely to be an important limiting factor in determining IL-12 production. This later point is consistent with the capacity of IL-4 to simultaneously increase p35 mRNA and IL-12 levels in DCs in response to microbial stimuli, while downregulating p40 mRNA and protein expression 13.

Among those transcription factors implicated in the control of IL-12 gene expression, Rel/nuclear factor (NF)-κB proteins, in particular c-Rel has been shown to be important for LPS-induced p40 transcription in macrophages 14,15. Rel/NF-κB transcription factors are homodimeric and heterodimeric proteins composed of related polypeptides that are encoded by a multigene family 16. The mammalian subunits (c-Rel, RelA, RelB, NF-κB1, and NF-κB2) share a conserved NH2-terminal domain that encompasses sequences required for DNA binding, dimerization, and nuclear localization 16. c-Rel, RelA, and RelB each possess COOH-terminal transcriptional transactivation domains. In contrast, the proteolytically processed 50- and 52-kD forms of NF-κB1 and NF-κB2, respectively, lack intrinsic transactivating properties and instead function as homodimeric repressors or modulators of the transactivating dimer partners 16. In most cells, Rel/NF-κB factors are retained in the cytoplasm as an inactive complex with inhibitor or IκB proteins 17. Diverse signals induce the nuclear translocation of Rel/NF-κB by activating an IκB kinase complex that phosphorylates the IκB proteins, targeting them for ubiquitin-dependent proteosome-mediated degradation 17,18. Upon translocation to the nucleus, Rel/NF-κB proteins regulate gene expression by binding to specific sequences (κB elements) located within the transcriptional regulatory regions of cellular genes, particularly those encoding proteins involved in immune, acute phase, and inflammatory responses 16.

Although Rel/NF-κB regulation of IL-12 expression has been studied most extensively in macrophages and monocytic cell lines 1,8,14,15,19, the critical function DCs serve in initiating antigen-dependent T cell responses 2,3,4,5,6, prompted us to examine what role the Rel/NF-κB pathway has in controlling IL-12 expression in these APCs. Here we show using mice that lack various individual members of the Rel/NF-κB family, that in CD8+ splenic DCs the rapid upregulation of IL-12 in response to microbial stimuli is dramatically reduced in the absence of c-Rel. In contrast to previous findings for c-rel/− macrophages that show an inability to upregulate IL-12 coincided with a failure to induce p40 transcription 15, in CD8+ DCs this defect is primarily due to impaired p35 gene expression. Consistent with this finding, we also establish that the p35 gene is a direct transcriptional target of c-Rel.

Materials And Methods

Mice.

C57BL/6 mice were bred under specific pathogen free conditions in the animal facility of The Walter and Eliza Hall Institute. The generation of c-rel/20, nfkb1/21, and rela/− mice 22 has been described previously. All mutant mouse strains have been backcrossed for eight or more generations with C57BL/6 mice.

Cytokines, Antibodies, and Reagents.

Murine rGM-CSF and rIL-4 were gifts from Immunex Corp. Rat rIFN-γ (bioactive in mouse) was purchased from PeproTech. Murine rIL-12 p70 and murine rIL-12 (p40)2 were purchased from R&D Systems. Flt-3 ligand (Flt-3L) was produced from the CHO-flk2 cell line provided by N. Nicola (The Walter and Eliza Hall Institute). Pansorbin (fixed and heat killed Staphylococcus aureus [SAC]) was purchased from Calbiochem-Novabiochem, and lipopolysaccharide was obtained from Difco. An oligonucleotide containing a CpG motif (CpG) was synthesized by GeneWorks according to a published sequence (CpG1668). The fluorescence-conjugated antibody used for selecting DC was FITC-conjugated anti-CD11c (N418). Monoclonal antibodies were purified and labeled as published elsewhere 23,24.

Mouse DC Preparation.

DCs were extracted from mouse spleens as described 23. In brief, organs were chopped, digested with collagenase, treated with EDTA, and light density cells collected by density centrifugation. Non-DC lineage cells were depleted by coating them with a mixture of monoclonal antibodies and then removing the coated cells with magnetic beads coupled to anti–rat-IgG 24. The DC enriched preparations were then stained with an anti–CD11c-FITC conjugated mAb. Propidium iodide (PI) was added in the final wash to label dead cells. For cytometric sorting, the cells were gated for DC characteristics, namely high forward and side scatter plus bright staining for CD11c, with PI-labeled cells excluded. The purity of the sorted DCs was typically >98%.

Stimulation of DCs in Culture for IL-12 Production.

Sorted splenic mouse DCs (105) were cultured in 96-well round bottom plates in a final volume of 200 μl with an IL-12 stimulus (250 nM CpG DNA, 5 to 20 μg/ml of SAC, or 1 μg/ml of LPS) in the presence of IL-4 (100 U/ml or titrated), GM-CSF (200 U/ml or titrated), and IFN-γ (20 ng/ml or titrated). After 18 h of culture, the supernatant was collected, separated from cells by centrifugation, and stored at −70°C before analysis.

IL-12 Polypeptide Analysis by Western Blotting.

Aliquots of DC culture supernatants were subjected to SDS-PAGE (9% acrylamide) under non-reducing conditions. The electrophoresed proteins were transferred onto Immobilon-P membrane (Millipore) according to the manufacturer's instructions. Membranes were blocked with 5% BSA in PBS overnight at 4°C. IL-12 polypeptides were detected by incubation with biotinylated C17.8 (anti–IL-12 p40) monoclonal antibody (0.5 μg/ml in 1% BSA, 0.05% Tween 20 in PBS) for 1 h at 4°C, followed by incubation with streptavidin-horseradish peroxidase conjugate (Amersham LifeScience) dilution in 1% BSA, 0.05% Tween 20 in PBS for 1 h at 4°C. Membranes were then developed with Supersignal West Pico Chemiluminescent Substrate (Pierce Chemical Co.), according to the manufacturer's instructions.

Analysis of Mouse IL-12 by ELISA.

Aliquots of DC culture supernatants were assayed by two site ELISA. In brief, 96-well polyvinyl chloride microtiter plates (Dynatech Laboratories) were coated with the appropriate purified capture mAb, namely R2-9A5 (anti–mouse IL-12 p70; American Type Culture Collection) or C15.6 (anti–mouse IL-12 p40; BD PharMingen). Cytokine binding was then detected with an appropriate biotinylated detection mAb, namely R1-5D9 (anti–mouse IL-12 p40, American Type Culture Collection) or C17.8 (anti–mouse IL-12 p40, hybridoma provided by L. Schofield, The Walter and Eliza Hall Institute). The readout was obtained using streptavidin-horseradish peroxidase conjugate (Amersham Pharmacia Biotech) and a substrate solution containing 548 μg/ml ABTS (2,2′-Azino-bis(3-ethylbenz-thiazoline-6-sulfonic acid)) (Sigma-Aldrich) and 0.001% hydrogen peroxide (Ajax Chemicals) in 0.1 M citric acid, pH 4.2, which was scanned at an optical density of 405–490 nm. As the mouse IL-12 p40 ELISA also detects mouse IL-12 p70, p40 and (p40)2 levels were determined by subtracting the amount of mouse IL-12 p70 obtained with the mouse IL-12 p70 ELISA from values obtained with the mouse IL-12 p40 ELISA.

Northern Analysis of IL-12 p40 and p35 mRNA Expression.

For Northern blot analysis, groups of three mice were treated with Flt3-L (10 μg/day for 10 d) and the splenic DCs then isolated as described above. The administration of Flt3-L to C57BL/6 mice greatly enhances the number of splenic DCs (by >30-fold) without altering their IL-12 expression 25. Cultures of these DCs (13 × 106 DCs/5 ml culture) were stimulated for 4 h with DNA (0.5 μM) or LPS (1 μg/ml) in the presence of IFN-γ (20 ng/ml) and IL-4 (50 U/ml). Total RNA isolated from approximately 2 × 106 DCs using RNAagents (Promega) was fractionated on 1% formaldehyde-agarose gels and transferred onto Hybond-C membranes (Amersham LifeScience). Filters were baked, prehybridized in 50% formamide, 5× SCC, 0.02% Ficoll, 0.02% polyvinylpyrrolidine, 0.02% albumin, 500 μg/ml of denatured herring sperm DNA, and hybridized for 18 h at 42°C with radiolabeled probes at a concentration of 2 × 106 cpm/ml. Filters were washed in 0.2× SCC, 0.1% SDS at 65°C and exposed to autoradiography at −70°C. For successive hybridizations, filters were first boiled in 10 mM EDTA, 0.1% SDS to remove bound probe. The probes used were a 1.0-kb EcoRI-HindIII murine p40 cDNA 13, a 0.66-kb EcoRI-KpnI fragment derived by PCR from the murine p35 cDNA 13, and a 1.1-kb PstI rat glyceraldehyde-3-phosphatedehydrogenase cDNA 26 insert. Probes were radiolabeled by random primer extension with [α-32P]dATP to specific activities ranging between 5 × 108 and 109 cpm/μg.

Genomic Clones and Plasmid Constructs.

A 62-bp genomic clone encompassing nucleotides −425 to +196 of the murine IL-12 p35 gene 27 was isolated by PCR from C57BL6 liver genomic DNA and characterized by automated sequencing. This fragment was inserted into the promoterless reporter plasmid pA3luc 28 and designated p35κB-luc. The plasmid p35κBm-luc is a derivative of p35κB-luc in which the Rel/NF-κB binding site (5′-GGGAATCCC-3′) at −63 to −54 27 was altered by in vitro mutagenesis 29.

Transfections and Luciferase Assays.

The J774 and A7L.13 cell line 30 were transiently transfected using Superfect (QIAGEN) as described previously 31. Equimolar amounts (1–2 μg) of the p35 promoter reporter plasmids were transfected alone or with a threefold molar excess (10–12 μg) of the expression plasmids pDAMP56 or pDAMP56c-rel 32. Approximately 48 h later, transfected cells were harvested and luiferase assays performed on cell extracts that had been standardized for equivalent protein content. Transfections were performed five times, with a maximum variance of approximately 15% observed between replicate experiments.

Electrophoretic Mobility Shift Assays.

The p35κB probe was prepared by end-labeling the double stranded oligonucleotide 5′-GTTACCCCACTGGGAATCCCTTCAGCCACC-3′ and electrophoretic mobility shift assay (EMSA) reactions performed with 1–2 μg of nuclear extract as described previously 33. For competition analysis, a 50-fold excess of unlabeled p35κB or p35κBm (5′-GTTACCCCACTGTCAATAACTTCAGCCA-CC-3′) competitor DNA was added to the reaction at room temperature for 15 min before addition of the radiolabeled probe. For supershift analysis, antibodies that specifically recognize NF-κB1 (sc1192; Santa Cruz Biotechnology, Inc.), c-Rel 33, RelA (sc109), RelB (sc226), or NF-κB2 (sc298) were incubated with nuclear extracts on ice for 30 min. before adding radiolabeled probe. All EMSA reactions were incubated for 20 min at room temperature, 2 μl of Ficoll dye was added, and the reactions were fractionated on 5% nondenaturing polyacrylamide gels. Gels were then dried and exposed to autoradiography at −70°C.

Semiquantitative Reverse Transcription PCR.

Total RNA was isolated using RNAgents (Promega) from the cell line A7L.13 (106 cells) that were untreated or stimulated for 4 h with LPS (1 μg/ml) or CpG DNA (250 nM). cDNA synthesis on equivalent amounts of total RNA was performed essentially as described 31. For semiquantitative PCR, cDNA was added to a cocktail comprising 50 mM KCl, 2 mM MgCl2, 10 mM Tris-HCl, pH 8.3, 0.01% (wt/vol) gelatin, 0.5 mM dNTPs, 1 U of Taq polymerase, and 1 μM of each oligonucleotide in a final volume of 50 μl. After an initial 5-min denaturation at 94°C, the cDNA was amplified for 25 cycles with each cycle programmed for denaturation at 94°C for 45 s, annealing at 58°C for 60 s, followed by elongation at 72°C for 90 s. Samples were then fractionated on a 1% agarose gel. The sequence of the oligonucleotides used for the amplification of murine p35, p40, and β-actin mRNA were: p35 (forward, ATGATGACCCTGTGCCTTGG; reverse, CCT-TTGGGGAGATGAGATGT; product size 448 bp), p40 (forward, AACCTCACCTGTACACGCC; reverse CAAGTCCATGTTTCTTTGCACG; product size 309 bp), and β-actin (forward, CTGAAGTACCCATTGAACATGGC; reverse, CAGAGCAGTAATCTCCTTCTGCAT; product size 726 bp).

Results

c-Rel Is Essential for Induced Expression of IL-12 by CD8+ DCs.

To determine what role Rel/NF-κB transcription factors serve in regulating IL-12 expression by activated DCs, we used mutant mice that lacked either c-Rel, NF-κB1, or RelA. Equivalent numbers of purified splenic CD11c+ DCs isolated from c-rel/− and nfkb1/− mice, or lethally irradiated C57BL/6Ly5.1+ recipients engrafted with E13 rela/− fetal liver hemopoietic progenitors were stimulated in culture for 18 h with SAC or unmethylated DNA containing CpG motifs in the presence of a cytokine cocktail (IL-4, IFN-γ, and GM-CSF) previously shown to enhance IL-12 expression 13. Levels of p40, (p40)2, and IL-12 p70 secreted into culture supernatants were then measured by ELISA using anti–p40– and anti-p70–specific antibodies (Fig. 1). While the amount of IL-12 (Fig. 1 A) produced by activated rela/− (Fig. 1 A, lanes 7 and 11) and nfkb1/− (Fig. 1 A, lanes 8 and 12) DCs was only two and fourfold lower respectively than that secreted by wild-type cells (Fig. 1 A, lanes 5 and 9), IL-12 levels were reduced 30- to 50-fold in the c-rel/− DC cultures (Fig. 1 A, lanes 6 and 10). As this reduction in IL-12 was observed for DNA and SAC stimulated c-rel/− DCs, with the relative levels of IL-12 secreted by wild-type and c-rel/− cells in the absence of cytokines remaining unchanged (results not shown), this indicated the defect was not associated with a specific microbial stimulus nor was it due to impaired cytokine responsiveness. In contrast to p70 expression, the combined level of p40 and (p40)2 produced by wild-type and c-rel/− DCs (Fig. 1 B) were equivalent upon SAC activation (Fig. 1 B, lanes 9 and 10) and 50% higher in the c-rel/− cultures stimulated with DNA (Fig. 1 B, compare lanes 5 and 6). The combined p40 and (p40)2 level was also consistently twofold higher than normal in rela/− DC cultures (Fig. 1 B, lanes 5 and 7; 9 and 11).

Western blotting of culture supernatants fractionated on nonreducing gels and probed with anti-p40 antibodies (Fig. 2) confirmed the conclusions drawn from the ELISA assays. Both p40 and p40 homodimer levels secreted by rela/− (Fig. 2, lane 3) and c-rel/− (Fig. 2, lane 4) DCs were elevated slightly, but normal in nfkb1/− cells (Fig. 2, lane 2), whereas IL-12 p70 levels were reduced in nfkb1/− cultures (Fig. 2, lane 2) and barely detectable in c-rel/− DC supernatants (Fig. 2, lane 4). The finding that p40 and (p40)2 levels secreted by activated c-rel/− DCs were similar to that produced by normal DCs indicated the reduction in IL-12 expression was not simply an indirect outcome of decreased c-rel/− DC viability. This conclusion is consistent with our observation that CD11c+ DC survival is normal in the absence of c-Rel (unpublished data).

As the CD8+ population is the major source of IL-12 secreted by splenic CD11c+ DCs 7, a reduction or absence of CD8+ cells was one possible explanation for why IL-12 production by c-rel/− splenic DCs was reduced. This was addressed by examining the expression of various surface markers on wild-type and c-rel/− splenic DCs isolated from naive or FLT3 ligand treated mice. This data, summarized in Fig. 3, shows that the total number and phenotype of the CD8+ DC populations in naive or FLT3 ligand treated wild-type and c-rel/− mice were indistinguishable. p40, p70, and (p40)2 production by stimulated FLT3 ligand treated wild-type and c-rel/− DCs expressing intermediate (CD8int) or high (CD8hi) levels of CD8 were compared with the total CD11c+ population by Western blot analysis (Fig. 4). As expected, IL-12 expression in normal splenic CD11c+ DCs was accounted for by the CD8+ population (Fig. 4, lanes 2–4). In the c-rel/− CD8+ DCs, IL-12 p70 was absent (Fig. 4, lanes 5 and 6), but p40 and (p40)2 were present at normal levels (Fig. 4, compare lanes 2, 3, 5, and 6). Collectively these findings indicate that in CD8+ DCs, c-Rel is critical for the expression of IL-12 p70, but not p40 or (p40)2.

The comparatively normal induction of p40 and (p40)2 expression in c-rel/− DCs in response to SAC or DNA stimulation contrasted with recent reports showing c-Rel was essential for LPS-induced p40 expression in macrophages 15. To assess if this difference between c-rel−/− APCs reflected cell type and/or stimulus specificity, p40/(p40)2 and p70 IL-12 expression measured by ELISA was compared in wild-type and c-rel−/− CD11c+ splenic DCs stimulated with LPS (Fig. 5). Consistent with previous reports, LPS is a comparatively weak inducer of p40/(p40)2 and IL-12 in wild-type DCs 13, with cytokine levels being approximately 100-fold lower (Fig. 5, lanes 3 and 7) than that seen for SAC or DNA stimulated DCs (Fig. 1a and Fig. b, lanes 5 and 9). Despite the weak induction of p40/(p40)2 and p70 by LPS, the same pattern of expression was observed for LPS, SAC, and DNA stimulated c-rel/− DCs. No IL-12 was detected in LPS stimulated c-rel/− DC cultures (Fig. 5, lane 4), whereas p40/(p40)2 expression was evident, albeit reduced slightly (<twofold) compared with wild-type cells (Fig. 5, lanes 4 and 8). These findings indicate that the c-Rel–dependent regulation of p40/(p40)2 expression appears to differ in macrophages and DCs.

In CD8+ DCs, c-Rel Is Required for the Induced Expression of p35 but Not p40.

The reduced level of IL-12, but not p40 or (p40)2 produced by c-rel−/− CD8+ DC suggested that this defect may result from impaired p35 expression. This was assessed by comparing p35 and p40 gene expression in unstimulated and activated CD8+ DCs isolated from wild-type and Rel/NF-κB mutant mice. As IL-12 synthesized by activated CD8+ DCs can be detected within 2 h and reaches steady state levels within 10 h 13, RNA samples were taken 4 h after stimulation and subjected to Northern blot analysis (Fig. 6 A). Whereas p35 mRNA expression was strongly induced in wild-type cells upon activation (Fig. 6, lanes 1 and 2), it was barely upregulated in the stimulated c-rel−/− DCs (Fig. 6, lanes 3 and 4). p35 expression was induced in rela−/− (Fig. 6 A, lanes 5 and 6) and nfkb1−/− (Fig. 6 A, lanes 7 and 8) DCs, albeit at somewhat reduced levels in cells lacking NF-κB1. In contrast, p40 mRNA levels were upregulated to the same extent in normal and c-rel−/− CD8+ DCs (Fig. 6, lanes 2 and 4). A survey of p40 expression over an 18-h period confirmed that the level and induction kinetics of p40 expression were normal in activated c-rel−/− CD8+ DC (data not shown). In the absence of RelA (Fig. 6 A, lanes 5 and 6) or NF-κB1 (Fig. 6 A, lanes 7 and 8), induced p40 mRNA expression also appeared normal. The LPS-induced expression of p35 and p40 mRNA was also compared in wild-type and c-rel−/− CD8+ DCs (Fig. 6 B). While p35 mRNA levels were rapidly upregulated in response to LPS in wild-type DCs (Fig. 6, lane 2), it was undetectable in c-rel−/− cells (Fig. 6, lane 4). In contrast, LPS-induced p40 mRNA expression appeared normal in c-rel−/− DCs (Fig. 6, compare lanes 2 and 4). These findings indicate that the impaired induction of IL-12 in activated c-rel−/− CD8+ DCs results from an inability to upregulate p35 mRNA levels and that individually c-Rel, RelA, and NF-κB1 are all dispensable for SAC, LPS, or DNA induced p40 expression in CD8+ DCs.

c-Rel Directly Induces Transcription of the Murine p35 Gene.

To determine how c-Rel might regulate p35 gene expression, we first examined the murine p35 promoter. Although a putative κB element, 5′-GGGAATCCCT-3′ was located 63 nucleotides upstream of the major transcription start site in the sequence determined by Tone et al. 27, this motif differed in the p35 genomic sequence from an independent group 34. As both sequences were determined from C57BL6 mice, ruling out strain-specific polymorphisms, we decided to clone and sequence that region of the promoter encompassing the putative κB element and found it was identical to that reported by Tone et al. 27.

To establish if the κB-like motif was required for the c-Rel–dependent induction of p35 transcription, promoter reporter assays were performed. While macrophage cell lines such as J774 and W264 had been used successfully for p40 promoter studies 14,15, the differences in c-Rel regulated p40 expression observed in macrophages and DCs prompted us to compare c-Rel–regulated p35 promoter function in both cell types. We chose to use J774 cells and ATL-13, a murine cell line with DC characteristics (30: unpublished results). The suitability of A7L.13 for this study was first assessed by examining endogenous p35 and p40 gene expression in response to LPS or DNA stimulation (Fig. 7 A). In the absence of stimuli, p35 and p40 mRNA levels in A7L.13 cells as measured by semiquantitative reverse transcription PCR were undetectable (Fig. 7 A, lanes 1 and 4), but were induced within 4 h by LPS (Fig. 7 A, lanes 2 and 5) or DNA (Fig. 7 A, lanes 3 and 6). As these findings showed p35 expression was upregulated in A7L.13 cells by c-Rel–dependent stimuli in a manner similar to that observed in primary CD8+ DCs, this cell line was used for p35 promoter reporter transfections.

A region of the p35 gene that encompassed the putative κB element, including the 5′ untranslated region within exon 1 and extended 425 nucleotides upstream of the transcriptional start site (see Fig. 7 B) was inserted 5′ of the luciferase gene in the promoterless reporter plasmid, pluc3 28. This plasmid, designated p35κB-luc, was transiently transfected into J774 or A7L.13 cells in the absence or presence of an expression vector encoding c-Rel and the resultant data summarized in Fig. 7 C. The basal promoter activity (Fig. 7 C, lanes 3 and 9) of p35κB-luc was significantly higher than the parental vector (Fig. 7 C, lanes 1, 2, 7, and 8) in both cell lines and was further upregulated upon co-transfection with an expression vector for c-Rel (Fig. 7 C, lanes 4 and 10). The role of the putative κB site was assessed by mutating it to a version (5′-GTCAATAACT-3′) unable to bind Rel/NF-κB proteins. The plasmid, p35κBm-luc, which contained the mutant κB site within the context of the full length promoter, retained normal basal promoter activity in A7L.13 cells (Fig. 7 C, lane 11), but was reduced in J774 (Fig. 7 C, lane 5). Moreover, p35κBm-luc activity was not upregulated by c-Rel (Fig. 7 C, lanes 6 and 12) in either cell line. The reduced κB-dependent basal promoter activity in J774 but not A7L.13 is consistent with constitutive nuclear Rel/NF-κB levels being higher in the J774 cells (results not shown). These results indicate that the κB element within the p35 promoter was necessary and sufficient for Rel/NF-κB–dependent transcription.

Nuclear c-Rel Complexes Induced in Activated CD8+ DCs Bind the κB Element in the p35 Promoter.

The binding of c-Rel complexes to the p35κB site was examined using electrophoretic mobility shift assays (Fig. 8). Two major nuclear complexes in unstimulated wild-type (Fig. 8 A, lane 1) and c-rel/− (Fig. 8 A, lane 3) CD8+ DCs, designated C1 and C2, bound a probe encompassing the p35κB motif. Within 2 h of DNA or SAC (results not shown) treatment, a novel nuclear complex (C3) present in wild-type (Fig. 8 A, lane 2) but not c-rel/− (Fig. 8 A, lane 4) CD8+ DCs, bound the probe, while C2 binding was reduced. To determine which complexes specifically bound to the κB site, a probe with the mutant κB motif (5′-GTCAATAACT-3′) was used. Whereas the mutant probe failed to bind the constitutive C1 (Fig. 8 A, lanes 5–8) and inducible C3 complexes seen in wild-type DCs (Fig. 8 A, lane 6), C2 binding was unaffected in cells of both genotypes (Fig. 8 A, lanes 5–8). These findings indicated that only C1 and C3 bound the probe via the κB site.

The composition of C1 and C3 was examined by supershift analysis using antibodies specific for different Rel/NF-κB polypeptides (Fig. 8 B). The C3 complex was supershifted with antibodies specific for NF-κB1 (Fig. 8 B, lane 6) and c-Rel (Fig. 8 B, lane 7), but not RelA (Fig. 8 B, lane 8), NF-κB2, or Rel B (not shown), demonstrating that it mainly comprised a c-Rel/NF-κB1 heterodimer. Despite C1 binding being dependent on the p35κB element, the mobility of the complex was not typical of a Rel/NF-κB dimer, a conclusion supported by the inability of Rel/NF-κB–specific antibodies to inhibit its binding. This is consistent with our preliminary findings that indicate C1 is an HMG protein (unpublished data). Although C2 does not bind directly to the κB element, in some experiments C2 binding was reduced by preincubating with Rel/NF-κB–specific antisera. This result, however, was inconsistent between experiments (Fig. 8 B, compare lanes 6–8, 13–16). While the basis of this variability remains unclear, the predicted molecular weight of the C2 DNA binding protein as determined by cross-linking studies (unpublished data) indicates it is not a Rel/NF-κB family member.

Discussion

While a considerable amount of information has emerged on the control of IL-12 p40 gene expression, little is known about the transcriptional regulation of the p35 locus. Here we show the Rel/NF-κB signaling pathway is required for the induction of IL-12 in activated CD8+ splenic DCs and the impaired expression of IL-12, but not p40 or (p40)2 in c-rel/− CD8+ DCs is due to an inability to upregulate p35 transcription which is c-Rel dependent.

Previous studies have established that c-Rel is not essential for lymphocyte or monocyte development; rather it is required for a variety of activation associated functions in mature cells from these lineages such proliferation and cytokine production 20,35,36,37. The results presented here for DCs are consistent with these findings, namely the loss of c-Rel does not disrupt splenic DC development, but IL-12 expression by activated CD8+ DCs is impaired. Collectively, these data reinforce the notion that the indispensable roles served by c-Rel in the different hemopoietic lineages is strictly associated with the regulation of effector functions in mature cells. In contrast to c-Rel, an absence of RelB disrupts the differentiation of CD8+ myeloid DCs 38. The separate roles served by these different Rel/NF-κB proteins during the differentiation and function of DCs presumably reflects their regulation of distinct genes, a conclusion consistent with their different binding site specificity 39 and the inability of c-Rel and RelB to form heterodimers 40.

A direct association remains to be established between the impaired expression of IL-12 by c-rel/− APCs and the immune defects displayed by c-rel/− mice. This issue is complicated in part by the need to define what role particular APCs serve during immune responses. Whereas naive CD8+ DCs produce high amounts of IL-12 when activated 7,13, macrophages isolated from unprimed mice produce very low amounts of IL-12 19. Only in response to priming “in vivo” under inflammatory conditions or “in vitro” with GM-CSF, IFN-γ, and IL-4, are macrophages able to synthesize high levels of IL-12 19,41. Such findings may indicate that CD8+ DCs are the critical source of IL-12 during a primary immune response, while macrophages could be more important producers of IL-12 later in the response after adequate priming in the inflammatory milieu 2,3,42. Immune defects arising from the loss of c-Rel that might be explained in part by a reduction in IL-12 expression by APCs include the sensitivity of c-rel/− mice to Leishmania major 36 and the resistance of these mutant mice to collagen-induced arthritis 43, a disease model in which IL-12 is known to be important 1.

The data outlined in this paper shows that c-Rel induces p35 expression in CD8+ DCs activated by microbial agents. The rapid cRel-dependent induction of p35 transcription triggered by LPS, SAC, or DNA is most likely initiated through mammalian Toll-like receptors (TLRs), which represent an evolutionarily conserved component of immunity. For example, in Drosophila, innate immune responses to microbes are mediated by various antimicrobial peptides, the expression of which are induced through Toll signaling by Relish and Dif, the invertebrate counterparts of Rel/NF-κB, 44.

Both cRel and NF-κB1, but not RelA are required for maximal IL-12 expression by CD8+ DCs, with their respective contributions to the induction of p70 reflecting the extent to which these transcription factors regulate p35 expression. The absence of c-Rel resulted in a 30 to 50-fold decrease in IL-12 levels that coincided with a reduction of similar magnitude in p35 mRNA. Without NF-κB1, a reproducible drop of three- to fourfold in both p35 mRNA and IL-12 levels was observed. In contrast, the induced levels of p40 mRNA, p40 monomer, and homodimer made by activated CD8+ DCs lacking these transcription factors was unchanged. This shows that in CD8+ DCs, the induction of p70 by Rel/NF-κB is regulated through p35 rather than p40 expression. Consistent with c-Rel and NF-κB1 both being necessary for optimal p35 expression in CD8+ DCs is the finding that NF-κB1/c-Rel is the major induced complex that binds the κB site in the p35 promoter. c-Rel, however, is the most important of the dimer partners for p35 expression. Similar findings for the relative contributions of these subunits in the regulation of A1 and IRF-4, two genes rapidly induced in activated B cells 31,45, reinforces the notion that NF-κB1 is mainly involved in modulating the c-Rel–dependent transcription of these genes. The p35 κB element, 5′-GGGAATCCC-T-3′ is closely related to the sequence 5′-GGGATCC-3′, which is conserved within the three functional κB sites found in the A1 and IRF-4 promoters that bind NF-κB1/c-Rel and c-Rel homodimers 31,45. The p35 promoter data reinforces our previous proposal that the sequence 5′-GGGATCC-3′ is a signature for functional κB sites that preferentially bind these Rel/NF-κB dimers 31.

In CD8+ DCs, IL-12 p70 expression coincides with a rapid induction of both p35 and p40 mRNAs in response to DNA, SAC, LPS, or CD40 9 stimulation. Although the coordinated expression of both genes is consistent with a common mode of transcriptional regulation, p35 but not p40 transcription was found to depend on c-Rel and NF-κB1 in these cells. This result was unexpected given a previous report showing c-Rel was necessary for induced p40 expression in macrophages 15. The most likely explanation for this difference is cell-type specific transcriptional regulation of p40. If this were the case, it is unlikely that p40 transcription in CD8+ DCs is dependent on another Rel/NF-κB family member such as RelA, an effective activator of p40 promoter-reporters 15, as p40 expression was slightly elevated rather than diminished in rela/− DCs. Despite c-Rel, RelA, and NF-κB1 all being individually dispensable for p40 expression in CD8+ DCs, it remains to be determined whether this truly reflects Rel/NF-κB–independent regulation of this gene or redundancy amongst these transcription factors 37. Cell-type–specific regulation of inducible gene expression by c-Rel has been documented previously for GM-CSF. In T cells, c-Rel is required for the optimal induction of GM-CSF 35, whereas it is dispensable for its expression in elicited peritoneal macrophages, and functions as a repressor of GM-CSF transcription in resident peritoneal macrophages 36. Such differences seen for both GM-CSF and p40 could be explained by selective interactions between c-Rel and other DNA binding proteins or coactivators in the various cell types. To date the most detailed molecular information on the role of Rel/NF-κB signaling in IL-12 regulation comes from the study p40 transcription in macrophages 15. LPS induction of p40 transcription in these cells is dependent upon c-Rel, which is activated through TRL-4 46. While this requires nucleosome remodeling of the p40 promoter 46, an event also regulated through this Toll-like receptor, it is independent of c-Rel and appears to involve a novel pathway. Ongoing studies aimed at comparing the role(s) c-Rel serves in determining the chromatin structure of the p35 and p40 promoters in various cell types in response to different stimuli, should increase our understanding of how IL-12 is regulated at the transcriptional level.

Acknowledgments

The authors thank Professor D. Baltimore (Caltech) for generously supplying the nfkb1/− and rela/− mice, the WEHI flow cytometry laboratory for cell sorting, and various members of the Shortman laboratory for advice and reagents.

This work was supported by the National Health and Medical Research Council, Australia and the Anti-Cancer Council of Victoria (S. Gerondakis). H. Hochrein was supported by a Deutsche Krebshilfe fellowship.

References

References
Trinchieri
G.
Interleukin-12a cytokine at the interface of inflammation and immunity
Adv. Immunol.
70
1998
83
243
[PubMed]
Banchereau
J.
,
Steinman
R.M.
Dendritic cells and the control of immunity
Nature.
392
1998
245
252
[PubMed]
Steinman
R.M.
,
Pack
M.
,
Inaba
K.
Dendritic cells in the T-cell areas of lymphoid organs
Immunol. Rev.
156
1997
25
37
[PubMed]
Heufler
C.
,
Koch
F.
,
Stanzl
U.
,
Topar
G.
,
Wysocka
M.
,
Trinchieri
G.
,
Enk
A.
,
Steinman
R.M.
,
Romani
N.
,
Schuler
G.
Interleukin-12 is produced by dendritic cells and mediates T helper 1 development as well as interferon-gamma production by T helper 1 cells
Eur. J. Immunol.
26
1996
659
668
[PubMed]
Maldonado-Lopez
R.
,
De Smedt
T.
,
Michel
P.
,
Godfroid
J.
,
Pajak
B.
,
Heirman
C.
,
Thielemans
K.
,
Leo
O.
,
Urbain
J.
,
Moser
M.
CD8α+ and CD8α− subclasses of dendritic cells direct the development of distinct T helper cells in vivo
J. Exp. Med.
189
1999
587
592
[PubMed]
Pulendran
B.
,
Smith
J.L.
,
Gaspary
G.
,
Brasel
K.
,
Pettit
D.
,
Maraskovsky
E.
,
Maliszewski
C.R.
Distinct dendritic cell subsets differentially regulate the class of immune response in vivo
Proc. Natl. Acad. Sci. USA.
96
1999
1036
1041
[PubMed]
Hochrein
H.
,
Shortman
K.
,
Vremec
D.
,
Scott
B.
,
Hertzog
P.
,
O'Keeffe
M.
Differential production of IL-12, IFN-α, and IFN-γ by mouse dendritic cell subsets
J. Immunol.
166
2001
5448
5455
[PubMed]
Snijders
A.
,
Hilkens
C.M.
,
van der Pouw Kraan
T.C.
,
Engel
M.
,
Aarden
L.A.
,
Kapsenberg
M.L.
Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocytes is determined by the expression of the p35 subunit
J. Immunol.
156
1996
1207
1212
[PubMed]
Schulz
O.
,
Edwards
A.D.
,
Schito
M.
,
Aliberti
J.
,
Manickasingham
S.
,
Sher
A.
,
Sousa
C. R.
CD40 triggering of heterodimeric IL-12 p70 production by dendritic cells in vivo requires a microbial priming signal
Immunity.
13
2000
453
462
[PubMed]
D'Andrea
A.
,
Rengaraju
M.
,
Valiante
N.M.
,
Chehimi
J.
,
Kubin
M.
,
Aste
M.
,
Chan
S.H.
,
Kobayashi
M.
,
Young
D.
,
Nickbarg
E.
Production of natural killer cell stimulatory factor (interleukin 12) by peripheral blood mononuclear cells
J. Exp. Med
176
1992
1387
1398
[PubMed]
Heinzel
F.P.
,
Hujer
A.M.
,
Ahmed
F.N.
,
Rerko
R.M.
In vivo production and function of IL-12 p40 homodimers
J. Immunol
158
1997
4381
4388
[PubMed]
Gillesson
S.
,
Carvajal
D.
,
Ling
P.
,
Podlaski
F.J.
,
Stremlo
D.L.
,
Familletti
P.C.
,
Gubler
U.
,
Presky
D.H.
,
Stern
A.S.
,
Gately
M.K.
Mouse interleukin-12 (IL-12) p40 homodimera potent IL-12 antagonist
Eur. J. Immunol
25
1995
200
206
[PubMed]
Hochrein
H.
,
O'Keeffe
M.
,
Luft
T.
,
Vandenabeele
S.
,
Grumont
R.J.
,
Maraskovsky
E.
,
Shortman
K.
Interleukin (IL)-4 is a major regulatory cytokine governing bioactive IL-12 production by mouse and human dendritic cells
J. Exp. Med
192
2000
823
833
[PubMed]
Murphy
T.L.
,
Cleveland
M.G.
,
Kulesza
P.
,
Magram
J.
,
Murphy
K.M.
Regulation of interleukin 12 p40 expression through an NF-κB half-site
Mol. Cell. Biol.
15
1995
5258
5267
[PubMed]
Sanjabi
S.
,
Hoffmann
A.
,
H-C. Liou
D.
,
Baltimore
,
Smale
S.T.
Selective requirement for c-Rel during IL-12 p40 gene induction in macrophages
Proc. Natl. Acad. Sci. USA.
97
2000
12705
12710
[PubMed]
Baldwin
A.S.
Jr.
The NF-κB and IκB proteinsnew discoveries and insights
Annu. Rev. Immunol.
14
1996
649
683
[PubMed]
Whiteside
S.T.
,
Israel
A.
IκB proteinsstructure, function and regulation
Semin. Cancer Biol.
8
1997
75
82
[PubMed]
Karin
M.
How NF-κB is activatedthe role of the IκB kinase (IKK) complex
Oncogene.
18
1999
6867
6874
[PubMed]
Skeen
M.J.
,
Miller
M.A.
,
Shinnick
T.M.
,
Zeigler
H.K.
Regulation of murine macrophage IL-12 production. Activation of macrophages in vivo, restimulation in vitro, and modulation by other cytokines
J. Immunol
156
1996
1196
1206
[PubMed]
Kontgen
F.
,
Grumont
R.J.
,
Strasser
A.
,
Metcalf
D.
,
Li
R.
,
Tarlinton
D.
,
Gerondakis
S.
Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression
Genes Dev
9
1995
1965
1977
[PubMed]
Sha
W.C.
,
Liou
H.C.
,
Toumanen
E.I.
,
Baltimore
D.
Targeted disruption of the p50 subunit of NF-kappa b leads to multifocal defects in immune responses
Cell
80
1995
321
330
[PubMed]
Beg
A.A.
,
Sha
W.C.
,
Bronson
R.T.
,
Ghosh
S.
,
Baltimore
D.
Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-κB
Nature.
376
1995
167
170
[PubMed]
Vremec
D.
,
Zorbas
M.
,
Scollay
R.
,
Saunders
D.J.
,
Ardavin
C.F.
,
Wu
L.
,
Shortman
K.
The surface phenotype of dendritic cells purified from mouse thymus and spleeninvestigation of the CD8 expression by a subpopulation of dendritic cells
J. Exp. Med
176
1992
47
58
[PubMed]
Vremec
D.
,
Shortman
K.
Dendritic cell subtypes in mouse lymphoid organscross-correlation of surface markers, changes with incubation, and differences among thymus, spleen, and lymph nodes
J. Immunol.
159
1997
565
573
[PubMed]
Maraskovsky
E.
,
Brasel
K.
,
Teepe
M.
,
Roux
E.R.
,
Lyman
S.D.
,
Shortman
K.
,
McKenna
H.J.
Dramatic increase in the numbers of functionally mature dendritic cells in mice treated with Flt3 ligandmultiple dendritic cell subpopulations identified
J. Exp. Med
184
1996
1953
1962
[PubMed]
Piechaczyk
M.
,
Blanchard
J.M.
,
Marty
L.
,
Dani
C.
,
Panabieres
F.
,
El Sabouty
S.
,
Fort
P.
,
Jeanteur
P.
Post-transcriptional regulation of glyceraldehyde 3-phosphate-dehydrogenase gene expression in rat tissues
Nucleic Acids Res.
12
1984
6951
6963
[PubMed]
Tone
T.
,
Thompson
S.A.
,
Babick
J.M.
,
Nolan
K.F.
,
Tone
M.
,
Raven
C.
,
Waldman
H.
Structure and chromosomal location of the mouse interleukin-12 p35 and p40 subunit genes
Eur. J. Immunol.
26
1996
1222
1227
[PubMed]
Maxwell
I.H.
,
Harrison W
G.S.
,
Wood
M.
,
Maxwell
F.
A DNA cassette containing a trimerized SV40 polyadenylation signal which efficiently blocks spurious plasmid-initiated transcription
Biotechniques.
7
1989
276
280
[PubMed]
Ho
S.N.
,
Hunt
H.D.
,
Horton
R.M.
,
Pullen
J.K.
,
Pease
L.R.
Site-directed mutagenesis by overlap extension using the polymerase chain reaction
Gene
77
1989
51
59
[PubMed]
Alexander
B.
,
Berger
R.
,
Day
L.
,
Hogarth
P.M.
,
Feneziani
A.
,
Cook
W.
Tumor-associated karyotypic lesions co-selected with in vitro macrophage differentiation
Genes Chrom. Cancer
5
1992
286
298
[PubMed]
Grumont
R.J.
,
Gerondakis
S.
Rel induces interferon regulatory factor 4 (IRF-4) expression in lymphocytesmodulation of interferon-regulated gene expression by Rel/Nuclear factor κB
J. Exp. Med
191
2000
1281
1291
[PubMed]
Grumont
R.J.
,
Richardson
I.B.
,
Gaff
C.
,
Gerondakis
S.
Rel/NF-κB nuclear complexes that bind κB sites in the murine c-rel promoter are required for constitutive c-rel transcription in B-cells
Cell Growth Diff
4
1993
731
743
[PubMed]
Grumont
R. J.
,
Gerondakis
S.
The subunit composition of NF-κB complexes changes during B-cell development
Cell Growth Diff.
5
1994
1321
1331
[PubMed]
Yoshimoto
T.
,
Kojima
K.
,
Funakoshi
T.
,
Endo
Y.
,
Fujita
T.
,
Nariuchi
H.
Molecular cloning and characterization of murine IL-12 genes
J. Immunol.
156
1996
1082
1088
[PubMed]
Gerondakis
S.
,
Strasser
A.
,
Metcalf
D.
,
Grigoriadis
G.
,
Scheerlinck
J.-P.Y.
,
Grumont
R.G.
Rel-deficient T cells exhibit defects in production of interleukin 3 and granulocyte-macrophage colony-stimulating factor
Proc. Natl. Acad. Sci. USA.
93
1996
3405
3409
[PubMed]
Grigoriadis
G.
,
Zhan
Y.
,
Grumont
R.J.
,
Metcalf
D.
,
Handman
E.
,
Cheers
C.
,
Gerondakis
S.
The Rel subunit of NF-κB-like transcription factors is a positive and negative regulator of macrophage gene expressiondistinct roles for Rel in different macrophage populations
EMBO J
15
1996
7099
7107
[PubMed]
Gerondakis
S.
,
Grossmann
M.
,
Nakamura
Y.
,
Pohl
T.
,
Grumont
R. J.
Genetic approaches in mice to understand Rel/NF-κB and IκB functiontransgenics and knockouts
Oncogene
18
1999
6888
6895
[PubMed]
Wu
L.
,
D'Amico
A.
,
Winkel
K.D.
,
Suter
M.
,
Lo
D.
,
Shortman
K.
RelB is essential for the development of myeloid-related CD8α-dendritic cells but not of lymphoid related CD8α+ dendritic cells
Immunity
9
1998
839
847
[PubMed]
Kunsch
C.
,
Rubin
S.M.
,
Rosen
C.A.
Selection of optimal kappa B/Rel DNA-binding motifsinteraction of both subunits of NF-kappa B with DNA is required for transcriptional activation
Mol. Cell. Biol.
12
1992
4412
4421
[PubMed]
Rubin
S.M.
,
Klement
J.F.
,
Coleman
T.A.
,
Maher
M.
,
Chen
C.H.
,
Rosen
C.A.
I-Rela novel rel-related protein that inhibits NF-kappa B transcriptional activity
Genes Dev
6
1992
745
760
[PubMed]
Hayes
M.P.
,
Wang
J.
,
Norcross
M.A.
Regulation of interleukin-12 expression in human monocytesselective priming by interferon-gamma of lipopolysaccharide-inducible p35 and p40 genes
Blood
86
1995
646
650
[PubMed]
Gorak
P.M.
,
Engwerda
C.R.
,
Kaye
P.M.
Dendritic cells, but not macrophages, produce IL-12 immediately following Leishmania donovani infection
Eur. J. Immunol.
28
1998
687
695
[PubMed]
Campbell
I.K.
,
Gerondakis
S.
,
O'Donnell
K.
,
Wicks
I.P.
Distinct roles for the NF-κB1(p50) and c-Rel transcription factors in inflammatory arthritis
J. Clin. Invest
105
2000
1799
1806
[PubMed]
Drier
E.A.
,
Steward
R.
The dorsoventral signal transduction pathway and the Rel-like transcription factors in Drosophila
Semin. Cancer Biol.
8
1997
83
92
[PubMed]
Grumont
R.J.
,
Rourke
I.J.
,
Gerondakis
S.
Rel-dependent induction of A1 transcription is required to protect B cells from antigen receptor ligation-induced apoptosis
Genes Dev.
13
1999
400
411
[PubMed]
Weinmann
A.S.
,
Mitchell
D.M.
,
Sanjabi
S.
,
Bradley
M.N.
,
Hoffmann
A.
,
Liou
H.C.
,
Smale
S.T.
Nucleosome remodeling at the IL-12 p40 promoter is a TLR-dependent, Rel-independent event
Nat. Immunol
2
2001
51
57
[PubMed]

R. Grumont and H. Hochrein contributed equally to this work.

H. Hochrein's present address is Medical Microbiology, Department of Immunology and Hygiene, Technical University of Munich, Munich D-81675, Germany.

Abbreviations used in this paper: DC, dendritic cell; EMSA, electrophoretic mobility shift assay; NF, nuclear factor; SAC, Staphylococcus aureus.