Interleukin (IL)-4 and IL-12 together with T cell receptor (TCR) engagement are crucial for the differentiation of CD4+ T cells into T helper (Th)2 or Th1 cells, respectively. Although IL-4 receptors (IL-4Rs) but not IL-12Rs are expressed on naive CD4+ T cells, IL-4 has no apparent advantage over IL-12 in driving naive T cell differentiation when the cells are primed with both IL-4 and IL-12 in vitro. It was found that IL-4–induced phosphorylation of Janus kinases 1 and 3, IL-4Rα, signal transducer and activator of transcription 6, and insulin receptor substrate 2 was strikingly but transiently inhibited by TCR ligation both in conventional and TCR transgenic T cells. TCR engagement also blocked the expression of an IL-4–inducible gene. Signals induced by other cytokines, including IL-2, IL-6, and interferon α, but not by insulin-like growth factor 1, were also blocked by TCR engagement. The capacity of various inhibitors to reverse TCR-mediated inhibition of IL-4 signaling suggested that activation of the Ras–mitogen-activated protein kinase pathway and of the calcineurin pathway contribute to desensitizing IL-4R. IL-4 responsiveness returned at about the time (∼12 h) that IL-12–mediated signaling was first observed. Thus, through different mechanisms, neither IL-4R nor IL-12R has any clear advantage in polarizing cells; rather, the availability of cytokine is probably the limiting factor in this process.

Introduction

IL-4 plays a central role in regulating the behavior of hematopoietic cells. It controls the specificity of Ig class switching in B cells and Th2 polarization in T cells 1. IL-4 can act as a costimulant of lymphocyte growth and can prevent apoptosis 2,3. These functions of IL-4 are achieved through IL-4R–mediated signal transduction followed by specific gene expression 4.

IL-4 heterodimerizes the IL-4Rα chain and the IL-2Rγ chain (γc); γc is also shared by cytokine receptors for IL-2, IL-7, IL-9, and IL-15 5. The nonreceptor tyrosine kinases Janus kinase (Jak)1 and Jak3, constitutively associated with IL-4Rα and γc, respectively 6,7,8, become activated after IL-4 binding to its receptor and phosphorylate some or all of the conserved tyrosines of IL-4Rα. These phosphotyrosines and the immediately surrounding amino acids within IL-4Rα provide docking sites for the phosphotyrosine binding (PTB) domain proteins insulin receptor substrate (IRS)-1/2 9,10,11, Shc 12, and IL-4R interacting protein (FRIP) 13, and for signal transducer and activator of transcription (Stat)6 4,14.

Two major IL-4–signaling pathways are mediated by the PTB domain proteins and Stat6, respectively 15,16. The former is mainly important for cell proliferation and cell survival 17. The genes that are regulated by IL-4 through IRS-2 and other PTB domain adapters are unknown, whereas Stat6 is directly responsible for inducing expression of a set of IL-4–inducible genes 18,19,20,21. Although the role of IRS-2 and other PTB domain proteins during Th2 cell differentiation is unclear, Stat6 plays a critical role in driving this process 22,23,24,25.

Ligation of TCRs by antigen–MHC complexes on APCs triggers T cell activation 26. A second signal, mediated by the interaction of CD80/86 and CD28 or other molecules, is required for full activation 27. TCR ligation induces two major signal transduction pathways, the protein kinase C (PKC)–mitogen-activated protein kinase (MAPK) pathway and the calcium-dependent calcineurin-mediated pathway 28.

The differentiation of naive T cells in the Th1 or Th2 direction requires both TCR-mediated and cytokine (IL-12 or IL-4)-mediated signals. It is known that, in the presence of TCR-mediated signals, IL-4 activates Stat6, leading to the development of a Th2 response 22,23,24,25, whereas IL-12 activates Stat4 and causes development of a Th1 response 29,30,31. How the signals from the TCR and the cytokine receptors are integrated is not well understood.

IL-4–mediated activation of Stat6 may antagonize the capacity of IL-12 to drive Th1 differentiation 32,33. One aspect of this inhibition involves downregulating IL-12Rβ2 expression 33,34. Interestingly, IL-4 can induce strong signals in naive T cells whereas IL-12 fails to do so until its receptor is induced by TCR engagement for certain period of time. Despite this, IL-4 has no apparent advantage over IL-12 in driving T cell differentiation when both of them are present. To attempt to understand this, the early signaling events induced by IL-4 or IL-12 during T cell activation were studied. It was found that although IL-4 induced strong signals in naive T cells, this signal was strikingly but transiently inhibited by TCR engagement. Responsiveness returned after 12 h of TCR ligation at a time when the activated cells also respond to IL-12.

Materials And Methods

Mice and T Cell Purification.

8–12-wk-old BALB/c mice, B10.A mice, and TCR transgenic 5CC7/Rag2−/− mice were obtained from the Frederick Cancer Research and Development Center (Frederick, MD). Spleen T cells were purified through mouse T cell enrichment columns (R&D Systems). Naive CD4+ T cells were prepared as follows: lymph node cells were depleted of CD8+ cells, B220+ cells, and IAd+ cells by negative selection using FITC-labeled anti-CD8, anti-B220, and anti-IAd (BD PharMingen) plus anti–fluorescein-conjugated magnetic beads (PerSeptive Biosystems). The purified CD4+ T cells were then centrifuged on a discontinuous 50, 60, and 70% Percoll gradient. Cells with a density of >60% were collected and used for direct stimulation or priming. The purity of CD4+ T cells after purification is usually ∼98%. Of these, 90% are CD44low and CD62Lhigh. For the signaling experiments using soluble anti-CD3 or antigen, lymph node and spleen cells from BALB/c mice or lymph node cells from 5CC7/Rag2−/− mice and T cell–depleted spleen cells from B10.A mice were pooled and stimulated with soluble anti-CD3 or pigeon cytochrome C (PCC) peptide for 6 h. CD4+ T cells were purified by positive selection (through an automatic MACS machine) using anti–mouse CD4 (L3T4) MicroBeads (Miltenyi Biotec). Purified CD4+ T cells were then stimulated by IL-4 (1,000 U/ml) for 20 min and total cell lysates were made. T cell–depleted APCs were prepared by incubating spleen cells with anti-Thy1.2 and rabbit complement (Cedarlane Laboratories Limited) at 37°C for 45 min, and then irradiated at 3,000 rads.

Cell Culture and Priming.

Purified T cells or naive CD4+ T cells were treated with plate-bound anti-CD3 (2C11, 3 μg/ml; Harlan) and anti-CD28 (3 μg/ml; Harlan) in complete RPMI 1640 for various times. In some experiments, anti–IL-4 (11B11) or inhibitors were added to the culture during TCR engagement. At the end of TCR treatment, cells were washed and incubated with IL-4 (1,000 U/ml) for 20 min. MAPK kinase (MEK) inhibitor U0126 was purchased from Promega. PMA, ionomycin, PKC inhibitor (GF109203X), calcineurin inhibitors (cyclosporin A [CsA] and FK506), and protein synthesis inhibitor (cycloheximide) were purchased from Calbiochem. To study in vitro priming for cytokine expression, 106 naive CD4+ BALB/c T cells were cocultured with 107 irradiated T cell–depleted spleen cells in the presence of anti-CD3 (3 μg/ml), anti-CD28 (3 μg/ml), IL-2 (10 U/ml), and different combinations of anti–IL-4 (11B11, 10 μg/mL), IL-4 (1,000 U/ml), anti–IL-12 (10 μg/ml), and IL-12 (10 ng/ml) for 20 h. Cells were then washed and stimulated with anti-CD3, anti-CD28, IL-2, IL-4, and IL-12 for an additional 3 d. After incubation in IL-2 for an additional 3 d, cells were restimulated with plate-bound anti-CD3 and anti-CD28 for 6 h; monensin (2 μM) was present during the last 4 h. Cells were harvested for intracellular staining for IFN-γ and IL-4 expression.

Immunoprecipitation and Western Blotting.

Cytokine-treated cells (107 per sample) were harvested and lysed with 1 ml lysis buffer (50 mM Hepes, pH 7.0, 0.5% NP-40, 5 mM EDTA, 50 mM sodium chloride, 10 mM sodium pyrophosphate, and 50 mM sodium fluoride), freshly supplemented with inhibitors (1 mM sodium orthovanadate, 1 mM PMSF, and 10 μg/ml each of aprotinin, leupeptin, and pepstatin), on ice for 20 min. After centrifugation at 12,000 rpm for 15 min, supernatants were incubated with 2–3 μg antibody for 1 h on ice and precipitated with protein G–agarose (Pierce Chemical Co.) at 4°C overnight on a rocker. The complexes were then washed three times with lysis buffer and eluted with 2× SDS-PAGE loading buffer. The eluted samples were separated in 8 or 12% premade acrylamide gels (Novex) and transferred onto Immobilon-P membranes (Millipore). Membranes were then probed with specific antibodies followed by horseradish peroxidase–labeled secondary antibodies (Amersham Pharmacia Biotech) and visualized with Supersignal West Dura extended duration substrate (Pierce Chemical Co.). For some experiments, the probed membranes were stripped with stripping buffer (2% SDS, 62.5 mM Tris-HCl, pH 6.8, and 100 mM 2-ME) at 60°C for 30 min and then reprobed with a second antibody. Anti-Jak1 and anti-Jak3 antiserum for immunoprecipitation were purchased from Upstate Biotechnology (cat. nos. 06-272 and 06-342). Anti-Jak1 for Western blot was purchased from Santa Cruz Biotechnology, Inc. (cat. no. sc-277) and monoclonal anti-Jak3 for Western blot was from Upstate Biotechnology (cat. no. 05-406). Anti-Stat6, anti-Stat4, anti-Stat3, and anti-Stat5b were purchased from R&D Systems. Anti–phosphorylated tyrosine 4G10 and anti–IRS-2 were from Upstate Biotechnology. Anti–IL-4Rα (M2) for immunoprecipitation was a gift of Immunex Corporation (Seattle, WA). Anti–IL-4Rα, anti–p-ERK, and anti–ERK-1 for Western blot were purchased from Santa Cruz Biotechnology, Inc.

Flow Cytometry Analysis and Intracellular Staining.

For IL-4Rα chain or γc chain staining, lymph node cells from 5CC7/Rag2−/− mice were cocultured with T cell–depleted spleen cells in the presence of 0 or 1 μM PCC for 6 h, and stained with either anti–IL-4R (M1; Immunex), anti-γc (18361D; BD PharMingen), or rat isotype control for 30 min in FACS® buffer (PBS with 3% FCS). The cells were then washed three times in FACS® buffer and incubated with biotin-labeled anti–rat IgG. After further washing, they were stained with streptavidin-PE and FITC-labeled anti-CD4. For intracellular staining, cells were restimulated with plate-bound anti-CD3 and anti-CD28 for 6 h in the presence of monensin (2 μM) during the last 4 h. Harvested samples were fixed with 4% formaldehyde, washed, and permeabilized in 0.5% saponin/1% BSA in PBS before staining with anti–IL-4–PE and anti–IFN-γ–FITC (BD PharMingen). Samples were analyzed on a FACScan™ (Becton Dickinson).

Semiquantitative Reverse Transcription PCR.

Purified naive CD4+ T cells were stimulated with IL-4 (1,000 U/ml) in the absence or presence of plate-bound anti-CD3/anti-CD28 for 4 h. Total RNA was isolated using TRIzol (GIBCO BRL) and first strand cDNAs were made using the SuperScript™ Preamplification System (GIBCO BRL) according to the manufacturer's protocol. Semiquantitative PCR was carried out in a GeneAmp PCR system 9700 (PerkinElmer) using Platinum PCR SuperMix (GIBCO BRL) by a serial dilution of the cDNA templates. The primers for IL-4Rα were AATGTGACCTACAAGGAACC and ATGGCCACCAAGGGACTGCG. The primers for β-actin were GATGACGATATCGCTGCGCTG and TACGACCAGAGGCATACAGG.

Results

TCR Ligation Transiently Downregulates IL-4 Signaling.

Stat6 and IRS-2, two major IL-4R signaling molecules 4,15,16, are promptly tyrosine phosphorylated in response to IL-4 treatment of BALB/c splenic T (Fig. 1a and Fig. b) and CD4+ lymph node T (Fig. 1c and Fig. d) cells. However, if the cells were stimulated with plate-bound anti-CD3 plus anti-CD28 for 6 h, phosphorylation of both Stat6 and IRS-2 is dramatically inhibited; no change in the amounts of Stat6 or IRS-2 was observed, although IRS-2 levels are at the border of detectability. Interestingly, IL-4–induced phosphorylation of Stat6 was no longer inhibited after 22 h of TCR engagement (Fig. 1 A); IRS-2 phosphorylation was barely detectable at this time. Inhibition of Stat6 phosphorylation was observed within 1 h of TCR ligation and reached its maximum at 4 h. IRS-2 phosphorylation appeared even more sensitive to inhibition by TCR ligation, as it was almost fully blocked within 1 h of TCR engagement (Fig. 1 B).

Inhibition was observed when concentrations of anti-CD3 as low as 0.08 μg/ml were used to coat culture plates, and was almost complete at a coating concentration of 0.4 μg/ml (Fig. 1 C). If anti-CD28 was omitted, inhibition was less dramatic although still substantial, particularly for IRS-2. Anti-CD28 by itself caused no inhibition of IL-4–mediated phosphorylation of Stat6 or IRS-2 (Fig. 1 D).

Inhibition of IL-4–mediated phosphorylation was observed with a broad range of IL-4 concentrations from 100 U/ml (∼50 pg/ml) to 10,000 U/ml (∼5 ng/ml). Such phosphorylation was inhibited even if IL-4 was continuously present during the period of TCR ligation (data not shown).

Phosphorylation of Stat6 and IRS-2 by IL-4 depends on proximal events, including the tyrosine phosphorylation of Jak1, Jak3, and IL-4Rα 4,6,7,8. The IL-4–stimulated phosphorylation of these molecules was also inhibited by 6 h of TCR ligation (Fig. 2). As with Stat6, the amount of these molecules was not diminished by receptor engagement. In T cells that had been stimulated with plate-bound anti-CD3 and anti-CD28 for 22 h, the phosphorylation of Jak1, Jak3, and IL-4Rα was similar to or even greater than in resting T cells. Indeed, amounts of Jak3 and IL-4Rα, but not Jak1, were enhanced after 22 h of TCR ligation. Thus, TCR ligation inhibited essentially all early IL-4–mediated signaling events. The simplest explanation would be that the TCR signal inhibited the capacity of the Jak1 and/or Jak3 to respond to IL-4–mediated heterodimerization of IL-4Rα and γc. Mimicking TCR ligation with PMA plus ionomycin had the same or an even stronger effect on IL-4 signaling; this effect was also transient (data not shown).

TCR Ligation Also Inhibits Signaling Events Induced by Other Cytokines but Not by Insulin-like Growth Factor 1.

It has been reported that in primed T cells, TCR engagement inhibits IL-2–mediated phosphorylation of Stat5 35. To determine if that was true for resting T cells and if TCR ligation blocked signaling by other cytokines, we tested responses to IL-2, IL-6, and IFN-α in freshly prepared CD4+ T cells from BALB/c lymph nodes. 4 h of TCR ligation strikingly inhibited phosphorylation of key substrates (Stat5b, Stat3, and Jak1, respectively) in response to each of these cytokines; responses had returned by 22 h of TCR stimulation (Fig. 3). By contrast, IRS-2 phosphorylation induced by insulin-like growth factor (IGF)-1 was not inhibited by TCR ligation. This is particularly striking in view of the exquisite sensitivity of the IL-4R's induction of IRS-2 phosphorylation to inhibition by TCR ligation.

The Induction of an IL-4–responsive Gene Is Also Inhibited by TCR Engagement.

Although very few genes are known whose expression levels are rapidly upregulated by IL-4 in naive CD4+ T cells, one that does show this property is the IL-4Rα chain itself 36,37. The induction of IL-4Rα mRNA expression has been shown to depend on Stat6 activation. Upon IL-4 stimulation for 4 h, naive CD4+ T cells express approximately fivefold more IL-4Rα chain mRNA than cells not stimulated by IL-4 (Fig. 4). By contrast, if the cells were stimulated with IL-4 in the presence of anti-CD3 plus anti-CD28 for 4 h, IL-4Rα chain mRNA upregulation was completely inhibited, showing that TCR-mediated inhibition of IL-4 signaling is functional.

In other experiments, we showed that the TCR ligation–mediated inhibition of IL-4Rα mRNA upregulation was only transient: after TCR ligation for 20 h, IL-4 regained the ability to induce IL-4Rα chain mRNA (data not shown).

Soluble Anti-CD3 or Antigen Also Inhibits IL-4–mediated Signaling.

To determine whether more physiologic modes of TCR engagement also resulted in transient inhibitions of IL-4R–mediated signaling, we tested the effect of soluble anti-CD3 or of antigen in the presence of APCs.

Lymph node cells from BALB/c mice were stimulated with or without soluble anti-CD3 plus anti-CD28 for 6 h, and BALB/c spleen cells were used as APCs. Cultured CD4+ T cells were purified by positive selection on a MACS (Miltenyi Biotec). The purified T cells were then stimulated with IL-4 for 20 min. IRS-2 and Stat6 phosphorylation was inhibited, and Stat6 expression levels were unaffected (Fig. 5 A).

Lymph node cells from 5CC7/Rag2−/− mice were stimulated with PCC peptide in the presence of spleen cells from B10.A mice as APCs. IRS-2 and Stat6 phosphorylation in response to IL-4 was inhibited by stimulation with 1 or 100 μM peptide for a period of 6 h (Fig. 5 B). Although 100 μM PCC may have modestly diminished Stat6 expression, 1 μM had no effect. The regulation of cell surface markers CD25, CD69, and CD62L by PCC stimulation was also checked. Both CD25 and CD69 were upregulated, whereas CD62L was downregulated equally by 1 or 100 μM PCC stimulation for 6 h as expected, indicating normal cell activation (data not shown). Jak3 and IL-4Rα chain phosphorylation were also checked in these two experiments. Both were inhibited (data not shown), suggesting that TCR engagement inhibits IL-4 signaling through the same mechanism whether plate-bound anti-CD3 or a peptide–MHC complex on a living cell was used for stimulation. These results imply that inhibition of IL-4 signaling by TCR engagement is a feature of physiologic T cell activation.

Mechanism of Inhibition of IL-4 Signaling by TCR Ligation.

Although IL-4Rα expression was little affected by TCR ligation as judged by Western blot experiments, it is still possible that IL-4R expression on the cell surface was diminished. To exclude this possibility, we measured IL-4R surface expression on CD4+ T cells by flow cytometry. As the level of IL-4Rα expression on naive CD4+ T cells is low (∼400 receptors/cell 38), we used a three-step staining method for detection. Because of the potential of increasing the staining background when anti-CD3 was used, we measured IL-4Rα and γc chain expression on naive 5CC7/Rag2−/− cells that had been incubated with T cell–depleted APCs from B10.A mice but with or without PCC peptide for 6 h. Neither IL-4Rα nor γc (Fig. 6) expression was significantly diminished by PCC stimulation. Indeed, a subset of cells showed increased surface expression of γc as a result of stimulation with PCC. These results indicate that the inhibitory effects of TCR ligation are not mediated by downregulating the expression of IL-4R subunits on the cell surface.

As IFN-γ is known to antagonize IL-4 effects 39 and, in some systems, to block IL-4–mediated signaling as a result of suppressor of cytokine signaling (SOCS)1 induction 40, we tested supernatants of lymph node CD4 T cells stimulated for 6 h with plate-bound anti-CD3 plus anti-CD28 for inhibitory activity. Such supernatants failed to inhibit IL-4–mediated phosphorylation of either Stat6 or IRS-2 (data no shown). In addition, when freshly purified naive CD4+ T cells were exposed to recombinant IFN-γ directly or after 6 h of TCR engagement, we failed to detect Stat1 phosphorylation (data not shown). When T cells from IFN-γ−/− mice were studied, the inhibition of IL-4 signaling by TCR ligation was still observed (data not shown). Thus, it is unlikely that IFN-γ plays a role in inhibiting IL-4 signaling in T cells stimulated through their TCR for short periods of time.

To determine whether inhibition of IL-4–mediated signals by TCR engagement required new protein synthesis, cycloheximide was added to cultures during TCR engagement. Without new protein synthesis, IRS-2 phosphorylation was still inhibited as a result of TCR ligation, and Stat6 phosphorylation was only partially rescued (Fig. 7 A). However, the interpretation of this experiment is made difficult by the rather striking effects of cycloheximide treatment on the level of IL-4–mediated phosphorylation of IRS-2 in T cells that had not been treated with anti-CD3/anti-CD28.

TCR ligation may induce some inhibitory factors that enhance the inhibition of Stat6 phosphorylation. The obvious candidates for such a role are members of the SOCS family 41,42,43. However, when SOCS1, SOCS3, and cytokine-inducible SH2 protein 1 (CIS1) mRNA expression was checked after 4 h of TCR ligation, there was no significant change in the expression of these molecules (data not shown). Our results indicate that at least some of the inhibitory effects of TCR ligation on IL-4 signaling are independent of new protein synthesis.

It has been shown that activation of MEK and extracellular signal–regulated kinase (ERK) blocks IL-6–induced phosphorylation of Stat3, independent of new protein synthesis and without altering IL-6R expression 44. We studied the role of the PKC-MAPK pathway triggered by TCR activation on IL-4–mediated signaling by the addition of a specific MEK inhibitor. The addition of U0126 (Promega), a potent MEK inhibitor, during the period of TCR ligation completely rescued the capacity of the cells to phosphorylate Stat6 and IRS-2 in response to IL-4 (Fig. 7 B). The PKC inhibitor GF109203X 45 partially restored both IRS-2 and Stat6 phosphorylation in response to IL-4. This strongly suggests that the induction of the PKC-MAPK pathway in response to TCR ligation is involved in inhibition of IL-4 signaling.

To determine whether the calcineurin-mediated pathway contributes to inhibition, two calcineurin inhibitors, CsA and FK506, were used. Interestingly, these inhibitors rescued IRS-2 phosphorylation but had limited effects on Stat6 phosphorylation (Fig. 7 B).

As PMA and the calcium ionophore, ionomycin, can mimic to some extent the activation of the PKC-MAPK and calcineurin pathways elicited by TCR ligation, we tested the ability of these agents, individually or together, to inhibit IL-4 signaling. Ionomycin caused striking but incomplete inhibition of IL-4–induced phosphorylation of IL-4Rα, Jak3, Stat6, and IRS-2 (Fig. 7 C). FK506 and CsA restored IL-4–mediated phosphorylation in ionomycin-treated cells. Ionomycin-mediated inhibition of IL-4 signaling was not reversed by cycloheximide, suggesting that calcineurin's effect may not require nuclear factor of activated T cells (NFAT)-driven transcription and protein synthesis.

PMA by itself had only a modest effect on IL-4Rα phosphorylation, and none on Jak3 phosphorylation (Fig. 7 D). However, adding PMA to ionomycin resulted in complete inhibition of both IL-4Rα and Jak3 phosphorylation. The PKC inhibitor reversed the capacity of PMA to enhance the inhibitory activity of ionomycin. These results suggest that both the PKC-MAPK and the calcineurin pathways are important for desensitizing the IL-4R.

PMA dramatically activated MAPK (Fig. 7 E), as shown by the appearance of phosphorylated ERK-1 and ERK-2. As PMA alone had little effect on IL-4 signaling, this suggests that activation of the MAPK pathway by itself is not sufficient to desensitize IL-4R. Ionomycin alone was able to inhibit IL-4 signaling but did not activate MAPK, and this inhibition was not rescued by the MEK inhibitor (data not shown), suggesting that the calcineurin pathway may play a more important role in desensitizing IL-4R when sustained high intracellular calcium concentrations are achieved. However, the striking reversal by the MEK inhibitor of IL-4R desensitization induced in response to TCR ligation implies that the magnitude of the calcineurin effect induced by the TCR is insufficient for independent inhibition. That is, with TCR ligation, neither pathway alone is capable of inhibiting IL-4 signaling; both are required for full suppression.

As IL-4 signaling was only transiently inhibited by TCR engagement and MAPK plays an important role in this inhibition, we measured the degree of MAPK activity at different times after TCR engagement by immunoblotting with anti–phospho-MAPK. Phospho-MAPK was detectable at 1 h after TCR ligation, peaked at 4 h, and decreased at 20 h (Fig. 8 A). Furthermore, as the cells had regained the ability to respond to cytokines at 20 h, part of the MAPK activity seen at that time may be elicited by cytokines rather than TCR engagement. Thus, MAPK activity correlates temporally with TCR-mediated inhibition of IL-4 signaling.

Although the return of IL-4 signaling at 20 h might be explained by a diminution in the magnitude of TCR signaling, the cells may have changed their responsiveness to the inhibitory signal at that time. To explore this possibility, cells that had been activated by TCR ligation for 20 h were exposed to PMA plus ionomycin, a treatment that inhibits IL-4 signaling in naive T cells independent of TCR. These 20-h-activated T cells, unlike naive T cells, did not show inhibition of IL-4–induced Stat6 phosphorylation in response to PMA plus ionomycin (Fig. 8 B). These results indicate that the IL-4R became resistant to inhibition after 20 h of TCR engagement. Although the mechanism underlying resistance is unclear, the upregulation of IL-4R, Jak3, and Stat6 expression (Fig. 1, Fig. 2, and Fig. 8 B) may contribute to this resistance.

Possible Biological Importance.

As functional IL-4R but not IL-12R is expressed on naive CD4+ T cells 33,34,36,37,38, one might anticipate that polarization to the Th2 pathway would be favored when naive CD4 cells are primed in the presence of both IL-4 and IL-12. However, as TCR ligation transiently desensitizes IL-4R, this might serve to redress the balance in priming for a cytokine-producing phenotype. We wished to determine the dynamics of acquisition of competence to respond to IL-12 on the part of naive CD4 T cells and of their reestablishment of responsiveness to IL-4 in T cells that had been stimulated through their TCR. Naive CD4+ T cells were primed with anti-CD3 plus anti-CD28 in the presence of both IL-4 and IL-12 for various times, and Stat6 and Stat4 phosphorylation was checked. Although Stat6 phosphorylation was induced by IL-4 in naive CD4+ T cells, TCR ligation resulted in its inhibition; Stat6 phosphorylation did not return to normal until 12 h after initiation of TCR ligation (Fig. 9). By contrast, IL-12 did not induce Stat4 phosphorylation in resting, naive T cells; however, by 8 h of T cell ligation, Stat4 phosphorylation was induced by IL-12, and the degree of IL-12–mediated Stat4 phosphorylation did not further increase over times up to 20 h. Thus, the transient inhibition of IL-4 signaling as a result of TCR ligation may have ablated any potential advantage IL-4 might have, and gave IL-12 a greater opportunity to drive naive CD4+ T cells to polarize to Th1 cells.

For this observation to be of any significance in the polarization process, it would be important that the early cytokine environment have a substantial role to play in the decision of CD4 T cells to differentiate into Th1 or Th2 cells. To test this, naive CD4+ T cells were primed in the presence of IL-4 or anti–IL-4 and IL-12 or anti–IL-12 during the initial 20 h of culture; all of the cells were then stimulated in the presence of IL-4 and IL-12 for an additional 3 d. After another 3 d in IL-2 medium, the cells were stimulated with immobilized anti-CD3 plus anti-CD28, and the proportion of IL-4 and of IFN-γ–producing cells was measured (Fig. 10). Priming for the initial 20 h in the presence of IL-4 and anti–IL-12 suppresses priming for IFN-γ compared with priming in the presence of anti–IL-4 and anti–IL-12, whereas priming in the presence of IL-12 and anti–IL-4 enhances priming for IFN-γ compared with priming with anti–IL-4 and anti–IL-12. Cells that were primed with both IL-4 and IL-12 were similar to cells primed with anti–IL-4 and anti–IL-12. In a sense, it could be said that IL-12 strikingly reverses the inhibitory effect of IL-4 on early priming for IFN-γ production. This striking effect of transient exposure to different combinations of IL-4 and IL-12 in the first 20 h of culture is even more remarkable when one considers that the cells are insensitive to IL-4 for ∼12 h of this period and to IL-12 for ∼8 h. Thus, even a very brief exposure to a given cytokine environment early in the period of stimulation strikingly effects the polarization of cells despite the fact that they are cultured under identical conditions for the bulk of the priming period. These results strongly suggest that early cytokine-mediated signals received by CD4 T cells play an important role in their decision to polarize into the Th1 or Th2 phenotype. This emphasizes the potential importance of the TCR-mediated desensitization events that limit responsiveness of naive T cells to IL-4 and other type I and type II cytokines.

Discussion

In this study, it was shown that IL-4–mediated signals were strikingly but transiently inhibited by TCR engagement of naive T cells. This inhibition involved triggering of both the PKC-MAPK and calcineurin pathways. It has recently been reported by Ivashkiv and colleagues that the IL-2 signal was inhibited by TCR engagement in preactivated T cells and the inhibition was mediated by the PKC-MAPK pathway 35. We have also checked the IL-4 signal in activated cells and observed results quite similar to those described above for naive T cells (data not shown). In addition, we found that the IL-2 signal was also inhibited by TCR engagement in naive T cells. McMahon and colleagues have shown that sustained activation of the Raf–MEK-ERK pathway elicited cytokine unresponsiveness in T cells 46. These results are consistent in indicating that MAPK plays an important role in the cross-talk between TCR and cytokine signals. Our data further show that although MAPK activation is necessary, it is not sufficient to inhibit the IL-4 signal (Fig. 7C and Fig. D).

Our experiments reveal some new and potentially very critical points. One is that the cytokine signal returns after TCR ligation for a certain period of time. The mechanism through which sensitivity to IL-4 is regained is unclear. IL-4 itself did not contribute to the reacquisition of sensitivity, as the addition of anti–IL-4 antibody (11B11) during TCR engagement did not delay the return of sensitivity (Fig. 2). Downregulation of cell surface TCR and CD3 expression by TCR ligation could be an explanation for the return of sensitivity to IL-4 and other cytokines 35,47. As MAPK plays a critical role in this inhibition, the return of the cytokine signal may simply be due to a decrease of MAPK activity (Fig. 8 A). Alternatively, TCR ligation may cause the expression of a new protein(s) that reverses the inhibition caused by the TCR signal, as the cells activated by TCR ligation for 20 h did not show the inhibition of IL-4 signal by PMA plus ionomycin treatment (Fig. 8 B). We observed that IL-4Rα, Jak3, and Stat6 expression levels were induced by TCR engagement; such increased expression may offer a partial explanation of returned sensitivity (Fig. 1, Fig. 2, and Fig. 8 B). Clarifying the mechanism of signal return will be very interesting and potentially very important. Indeed, if cells lose the capacity to overcome transient inhibition and thus the cytokine signal does not return, they may become anergic.

Another new finding in our experiments is that the calcineurin pathway can play a major role in inhibiting IL-4 signaling. Indeed, ionomycin treatment by itself inhibits phosphorylation of IL-4Rα, Jak3, Stat6, and IRS-2 phosphorylation. FK506 rescues this inhibition and the inhibition of IRS-2 phosphorylation mediated by TCR engagement. CsA also reverses inhibition, but it was less effective. Calcineurin plays a major role in regulating NFAT activity, which in turn is critical for the transcription of cytokine genes 48. Nonetheless, the finding that an inhibitor of protein synthesis failed to reverse the effects of ionomycin suggests that inhibition of calcineurin blocks IL-4 signaling through an NFAT-independent pathway.

IL-4Rα as well as γc are expressed on naive CD4+ T cells, so such cells can immediately respond to IL-4 36,37,38. By contrast, IL-12Rβ2 is not expressed on naive cells; such cells are unresponsive to IL-12. However, IL-12Rβ2 can be induced by TCR ligation 33,34 and as these cells already express IL-12Rβ1, they gain responsiveness to IL-12. As IL-4 and IL-12 are the key cytokines in determining the commitment of naive T cells to the Th2 or Th1 phenotype, the differential expression and/or sensitivity of their receptors could be an important factor in determining the T cell phenotype polarization 1. This could be particularly important because IL-4 not only commits cells to become Th2 cells but also suppresses their capacity to develop into IFN-γ producers 1,32.

Our data also demonstrated that the presence of IL-4 unopposed by IL-12 during the first 20 h of culture strikingly changed the ratio of IL-4 to IFN-γ producers that developed upon subsequent culture in the presence of IL-4 and IL-12 for 3 d (Fig. 10). This skewing in the Th1/Th2 ratio was conserved even after a second round of priming (data not shown). This indicates that the early signals received by naive T cells play a critical role in determining the cells' differentiation fate. Indeed, the IL-4R was desensitized for 12 h, so the cells received effective IL-4 signals for only 8 h during the first 20 h of T cell activation. As the cells do not respond to IL-12 during the first 8 h, conditions involving IL-4 and anti–IL-12 for the first 20 h of culture may mimic the situation that would pertain if the IL-4R had not been desensitized by TCR ligation, providing IL-4 with an 8-h advantage over IL-12. Thus, one potential reason for regulating the IL-4R to make it insensitive for a period of ∼12 h after TCR ligation is to overcome the advantage IL-4 would have in the IL-4/IL-12 competition in view of the absence of functional IL-12R from resting T cells.

The opportunity to regulate the relative degree of responsiveness of the IL-4 and the IL-12R, one by controlling its desensitization and the other by controlling its induction, provides an additional mechanism through which the system can “tune” the degree of priming to the Th2 and Th1 phenotypes and thus the quality of T cell responses can be controlled. Such relatively fine quantitative adjustments may prove to have substantial real world significance. Almost certainly, in physiologic priming both inducers will be present to some degree, and the outcome will be determined both by their relative concentrations and by the relative degree of responsiveness of the cells to the two stimulants.

Balancing Th1/Th2 differentiation may not be the only or even the major consequence of transiently modulating cytokine signaling through TCR engagement, as the signaling of a broad range of cytokines is inhibited by TCR ligation. Indeed, as so many of the functions of cytokine receptors depend on costimulation through the TCR, analyzing the integration of TCR- and cytokine-mediated signal transduction will have substantial importance in efforts to develop and understand of the dynamics of cytokine-mediated processes.

Acknowledgments

We thank Dr. Angela Thornton for advice on MACS separations and Ms. Shirley Starnes for editorial assistance.

References

References
Seder
R.A.
,
Paul
W.E.
Acquisition of lymphokine-producing phenotype by CD4+ T cells
Annu. Rev. Immunol.
12
1994
635
673
[PubMed]
Vella
A.
,
Teague
T.K.
,
Ihle
J.
,
Kappler
J.
,
Marrack
P.
Interleukin 4 (IL-4) or IL-7 prevents the death of resting T cellsstat6 is probably not required for the effect of IL-4
J. Exp. Med.
186
1997
325
330
[PubMed]
Zamorano
J.
,
Wang
H.Y.
,
Wang
L.M.
,
Pierce
J.H.
,
Keegan
A.D.
IL-4 protects cells from apoptosis via the insulin receptor substrate pathway and a second independent signaling pathway
J. Immunol.
157
1996
4926
4934
[PubMed]
Nelms
K.
,
Keegan
A.D.
,
Zamorano
J.
,
Ryan
J.J.
,
Paul
W.E.
The IL-4 receptorsignaling mechanisms and biologic functions
Annu. Rev. Immunol.
17
1999
701
738
[PubMed]
Sugamura
K.
,
Asao
H.
,
Kondo
M.
,
Tanaka
N.
,
Ishii
N.
,
Ohbo
K.
,
Nakamura
M.
,
Takeshita
T.
The interleukin-2 receptor gamma chainits role in the multiple cytokine receptor complexes and T cell development in XSCID
Annu. Rev. Immunol.
14
1996
179
205
[PubMed]
Witthuhn
B.A.
,
Silvennoinen
O.
,
Miura
O.
,
Lai
K.S.
,
Cwik
C.
,
Liu
E.T.
,
Ihle
J.N.
Involvement of the Jak-3 Janus kinase in signalling by interleukins 2 and 4 in lymphoid and myeloid cells
Nature.
370
1994
153
157
[PubMed]
Yin
T.
,
Tsang
M.L.
,
Yang
Y.C.
JAK1 kinase forms complexes with interleukin-4 receptor and 4PS/insulin receptor substrate-1-like protein and is activated by interleukin-4 and interleukin-9 in T lymphocytes
J. Biol. Chem.
269
1994
26614
26617
[PubMed]
Chen
X.H.
,
Patel
B.K.R.
,
Wang
L.M.
,
Frankel
M.
,
Ellmore
N.
,
Flavell
R.A.
,
LaRochelle
W.J.
,
Pierce
J.H.
Jak1 expression is required for mediating interleukin-4 induced tyrosine phosphorylation of insulin receptor substrate and state signaling molecules
J. Biol. Chem.
272
1997
6556
6560
[PubMed]
Wang
L.M.
,
Keegan
A.D.
,
Li
W.
,
Lienhard
G.E.
,
Pacini
S.
,
Gutkind
J.S.
,
Myers
M.G.
Jr.
,
Sun
X.J.
,
White
M.F.
,
Aaronson
S.A.
Common elements in interleukin 4 and insulin signaling pathways in factor-dependent hematopoietic cells
Proc. Natl. Acad. Sci. USA.
90
1993
4032
4036
[PubMed]
Wang
L.M.
,
Myers
M.G.
Jr.
,
Sun
X.J.
,
Aaronson
S.A.
,
White
M.F.
,
Pierce
J.H.
IRS-1essential for insulin- and IL-4-stimulated mitogenesis in hematopoietic cells
Science.
261
1993
1591
1594
[PubMed]
Sun
X.J.
,
Wang
L.M.
,
Zhang
Y.
,
Yenush
L.
,
Myers
M.G.
Jr.
,
Glasheen
E.
,
Lane
W.S.
,
Pierce
J.H.
,
White
M.F.
Role of IRS-2 in insulin and cytokine signalling
Nature.
377
1995
173
177
[PubMed]
Wery
S.
,
Letourneur
M.
,
Bertoglio
J.
,
Pierre
J.
Interleukin-4 induces activation of mitogen-activated protein kinase and phosphorylation of shc in human keratinocytes
J. Biol. Chem.
271
1996
8529
8532
[PubMed]
Nelms
K.
,
Snow
A.L.
,
Hu-Li
J.
,
Paul
W.E.
FRIP, a hematopoietic cell-specific rasGAP-interacting protein phosphorylated in response to cytokine stimulation
Immunity.
9
1998
13
24
[PubMed]
Ryan
J.J.
,
McReynolds
L.J.
,
Huang
H.
,
Nelms
K.
,
Paul
W.E.
Characterization of a mobile Stat6 activation motif in the human IL-4 receptor
J. Immunol.
161
1998
1811
1821
[PubMed]
Ryan
J.J.
,
McReynolds
L.J.
,
Keegan
A.D.
,
Wang
L.H.
,
Garfein
E.
,
Rothman
P.
,
Nelms
K.
,
Paul
W.E.
Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor
Immunity.
4
1996
123
132
[PubMed]
Pernis
A.
,
Witthuhn
B.
,
Keegan
A.D.
,
Nelms
K.
,
Garfein
E.
,
Ihle
J.N.
,
Paul
W.E.
,
Pierce
J.H.
,
Rothman
P.
Interleukin 4 signals through two related pathways
Proc. Natl. Acad. Sci. USA.
92
1995
7971
7975
[PubMed]
Keegan
A.D.
,
Nelms
K.
,
White
M.
,
Wang
L.M.
,
Pierce
J.H.
,
Paul
W.E.
An IL-4 receptor region containing an insulin receptor motif is important for IL-4-mediated IRS-1 phosphorylation and cell growth
Cell.
76
1994
811
820
[PubMed]
Defrance
T.
,
Aubry
J.P.
,
Rousset
F.
,
Vanbervliet
B.
,
Bonnefoy
J.Y.
,
Arai
N.
,
Takebe
Y.
,
Yokota
T.
,
Lee
F.
,
Arai
K.
Human recombinant interleukin 4 induces Fc epsilon receptors (CD23) on normal human B lymphocytes
J. Exp. Med.
165
1987
1459
1467
[PubMed]
Mikita
T.
,
Kurama
M.
,
Schindler
U.
Synergistic activation of the germline epsilon promoter mediated by Stat6 and C/EBP beta
J. Immunol.
161
1998
1822
1828
[PubMed]
Shen
C.H.
,
Stavnezer
J.
Interaction of stat6 and NF-kappaBdirect association and synergistic activation of interleukin-4-induced transcription
Mol. Cell. Biol.
18
1998
3395
3404
[PubMed]
Linehan
L.A.
,
Warren
W.D.
,
Thompson
P.A.
,
Grusby
M.J.
,
Berton
M.T.
STAT6 is required for IL-4-induced germline Ig gene transcription and switch recombination
J. Immunol.
161
1998
302
310
[PubMed]
Shimoda
K.
,
van Deursen
J.
,
Sangster
M.Y.
,
Sarawar
S.R.
,
Carson
R.T.
,
Tripp
R.A.
,
Chu
C.
,
Quelle
F.W.
,
Nosaka
T.
,
Vignali
D.A.A.
Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene
Nature.
380
1996
630
633
[PubMed]
Takeda
K.
,
Tanaka
T.
,
Shi
W.
,
Matsumoto
M.
,
Minami
M.
,
Kashiwamura
S.
,
Nakanishi
K.
,
Yoshida
N.
,
Kishimoto
T.
,
Akira
S.
Essential role of Stat6 in IL-4 signalling
Nature.
380
1996
627
630
[PubMed]
Kaplan
M.H.
,
Schindler
U.
,
Smiley
S.T.
,
Grusby
M.J.
Stat6 is required for mediating responses to IL-4 and for the development of Th2 cells
Immunity.
4
1996
313
319
[PubMed]
Kurata
H.
,
Lee
H.J.
,
O'Garra
A.
,
Arai
N.
Ectopic expression of activated Stat6 induces the expression of Th2-specific cytokines and transcription factors in developing Th1 cells
Immunity.
11
1999
677
688
[PubMed]
Qian
D.
,
Weiss
A.
T cell antigen receptor signal transduction
Curr. Opin. Cell Biol.
9
1997
205
212
[PubMed]
Slavik
J.M.
,
Hutchcroft
J.E.
,
Bierer
B.E.
CD28/CTLA-4 and CD80/CD86 familiessignaling and function
Immunol. Res.
19
1999
1
24
[PubMed]
Cantrell
D.
T cell antigen receptor signal transduction pathways
Annu. Rev. Immunol.
14
1996
259
274
[PubMed]
Jacobson
N.G.
,
Szabo
S.J.
,
Weber-Nordt
R.M.
,
Zhong
Z.
,
Schreiber
R.D.
,
Darnell
J.E.
Jr.
,
Murphy
K.M.
Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4
J. Exp. Med.
181
1995
1755
1762
[PubMed]
Thierfelder
W.E.
,
van Deursen
J.M.
,
Yamamoto
K.
,
Tripp
R.A.
,
Sarawar
S.R.
,
Carson
R.T.
,
Sangster
M.Y.
,
Vignali
D.A.A.
,
Doherty
P.C.
,
Grosveld
G.C.
,
Ihle
J.N.
Requirement for Stat4 in interleukin-12-mediated responses of natural killer and T cells
Nature.
382
1996
171
174
[PubMed]
Kaplan
M.H.
,
Sun
Y.L.
,
Hoey
T.
,
Grusby
M.J.
Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice
Nature.
382
1996
174
177
[PubMed]
Ouyang
W.
,
Ranganath
S.H.
,
Weindel
K.
,
Bhattacharya
D.
,
Murphy
T.L.
,
Sha
W.C.
,
Murphy
K.M.
Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism
Immunity.
9
1998
745
755
[PubMed]
Himmelrich
H.
,
Parra-Lopez
C.
,
Tacchini-Cottier
F.
,
Louis
J.A.
,
Launois
P.
The IL-4 rapidly produced in BALB/c mice after infection with Leishmania major down-regulates IL-12 receptor beta 2-chain expression on CD4+ T cells resulting in a state of unresponsiveness to IL-12
J. Immunol.
161
1998
6156
6163
[PubMed]
Szabo
S.J.
,
Dighe
A.S.
,
Gubler
U.
,
Murphy
K.M.
Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and Th2 cells
J. Exp. Med.
185
1997
817
824
[PubMed]
Lee
I.H.
,
Li
W.P.
,
Hisert
K.B.
,
Ivashkiv
L.B.
Inhibition of interleukin 2 signaling and signal transducer and activator of transcription (STAT)5 activation during T cell receptor–mediated feedback inhibition of T cell expansion
J. Exp. Med.
190
1999
1263
1274
[PubMed]
Ohara
J.
,
Paul
W.E.
Up-regulation of interleukin 4/B-cell stimulatory factor 1 receptor expression
Proc. Natl. Acad. Sci. USA.
85
1988
8221
8225
[PubMed]
Renz
H.
,
Domenico
J.
,
Gelfand
E.W.
IL-4-dependent up-regulation of IL-4 receptor expression in murine T and B cells
J. Immunol.
146
1991
3049
3055
[PubMed]
Ohara
J.
,
Paul
W.E.
Receptors for B-cell stimulatory factor-1 expressed on cells of haematopoietic lineage
Nature.
325
1987
537
540
[PubMed]
Dickensheets
H.L.
,
Donnelly
R.P.
Inhibition of IL-4-inducible gene expression in human monocytes by type I and type II interferons
J. Leukoc. Biol.
65
1999
307
312
[PubMed]
Dickensheets
H.L.
,
Venkataraman
C.
,
Schindler
U.
,
Donnelly
R.P.
Interferons inhibit activation of STAT6 by interleukin 4 in human monocytes by inducing SOCS-1 gene expression
Proc. Natl. Acad. Sci. USA.
96
1999
10800
10805
[PubMed]
Starr
R.
,
Willson
T.A.
,
Viney
E.M.
,
Murray
L.J.L.
,
Rayner
J.R.
,
Jenkins
B.J.
,
Gonda
T.J.
,
Alexander
W.S.
,
Metcalf
D.
,
Nicola
N.A.
,
Hilton
D.J.
A family of cytokine-inducible inhibitors of signalling
Nature.
387
1997
917
921
[PubMed]
Endo
T.A.
,
Masuhara
M.
,
Yokouchi
M.
,
Suzuki
R.
,
Sakamoto
H.
,
Mitsui
K.
,
Matsumoto
A.
,
Tanimura
S.
,
Ohtsubo
M.
,
Misawa
H.
A new protein containing an SH2 domain that inhibits JAK kinases
Nature.
387
1997
921
924
[PubMed]
Naka
T.
,
Narazaki
M.
,
Hirata
M.
,
Matsumoto
T.
,
Minamoto
S.
,
Aono
A.
,
Nishimoto
N.
,
Kajita
T.
,
Taga
T.
,
Yoshizaki
K.
Structure and function of a new STAT-induced STAT inhibitor
Nature.
387
1997
924
929
[PubMed]
Sengupta
T.K.
,
Talbot
E.S.
,
Scherle
P.A.
,
Ivashkiv
L.B.
Rapid inhibition of interleukin-6 signalling and Stat3 activation mediated by mitogen-activated protein kinases
Proc. Natl. Acad. Sci. USA.
95
1998
11107
11112
[PubMed]
Toullec
D.
,
Pianetti
P.
,
Coste
H.
,
Bellevergue
P.
,
Grand-Perret
T.
,
Ajakane
M.
,
Baudet
V.
,
Boissin
P.
,
Boursier
E.
,
Loriolle
F.
The bisindolylmaleimide GF 109203X is a potent and selective inhibitor of protein kinase C
J. Biol. Chem.
266
1991
15771
15781
[PubMed]
Chen
D.
,
Heath
V.
,
O'Garra
A.
,
Johnston
J.
,
McMahon
M.
Sustained activation of the raf-MEK-ERK pathway elicits cytokine unresponsiveness in T cells
J. Immunol.
163
1999
5796
5805
[PubMed]
San Jose
E.
,
Borroto
A.
,
Niedergang
F.
,
Alcover
A.
,
Alarcon
B.
Triggering the TCR complex causes the downregulation of nonengaged receptors by a signal transduction-dependent mechanism
Immunity.
12
2000
161
170
[PubMed]
Rao
A.
,
Luo
C.
,
Hogan
P.G.
Transcription factors of the NFAT familyregulation and function
Annu. Rev. Immunol
15
1997
707
747
[PubMed]

Abbreviations used in this paper: γc, IL-2Rγ chain; CsA, cyclosporin A; ERK, extracellular signal–regulated kinase; IGF, insulin-like growth factor; IRS, insulin receptor substrate; Jak, Janus kinase; MAPK, mitogen-activated protein kinase; MEK, MAPK kinase; NFAT, nuclear factor of activated T cells; PCC, pigeon cytochrome c; PKC, protein kinase C; PTB, phosphotyrosine binding; SOCS, suppressor of cytokine signaling; Stat, signal transducer and activator of transcription.

J. Zhu and H. Huang contributed equally to this work.

H. Huang's present address is the Department of Cell Biology, Loyola University Strich School of Medicine, Maywood, IL 60153.