Ras is essential for the transition from early B cell precursors to the pro-B stage, and is considered to be involved in the signal cascade mediated by pre-B cell antigen receptors. To examine the role of p21ras in the late stage of B cell differentiation, we established transgenic mice (TG) expressing a dominant-inhibitory mutant of Ha-ras (Asn-17 Ha-ras) in B lineage cells at high levels after the early B cell precursor stage. Expression of p21Asn-17 Ha-ras was associated with a prominent reduction in the number of late pre-B cells, but had little effect on proliferation of early pre-B cells. Inhibition of p21ras activity markedly reduced the life span of pre-B cells, due, at least in part, to downregulation of the expression of an antiapoptotic protein, Bcl-xL. Thus, the apparent role for p21ras activity in pre-B cell survival may explain the decreased numbers of late pre-B cells in Asn-17 Ha-ras TG. Consistent with this possibility, overexpression of Bcl-2 in Asn-17 Ha-ras TG reversed the reduction in the number of late pre-B cells undergoing immunoglobulin light chain gene (IgL) rearrangement and progressing to immature B cells. These results suggest that p21ras mediates effector pathways responsible for pre-B cell survival, which is essential for progression to the late pre-B and immature B stages.

Committed B cell precursors undergo differentiation through several critical check points into surface immunoglobulin (sIg) positive immature B cells (for a review, see reference 1). The earliest recognizable B cell precursors were identified in bone marrow (BM) cells expressing CD43 and a low level of B220 2,3, and these cells progress to the pro-B stage. Successful IgH gene rearrangement and transient activation of surrogate light chain (SL) genes at the pro-B cell stage lead to expression of the pre-B cell antigen receptor (pre-BCR), which plays a pivotal role in allelic exclusion and in the pre-B transition 4,5,6,7,8. After expansion at the pre-B transition, pre-B cells increase the expression of the large isoform of Bcl-x (Bcl-xL; see references 9–11) and become competent to undergo rearrangement of the IgL gene, probably as a consequence of the late effect mediated by the pre-BCR 12,13,14.

The BCR and pre-BCR form a complex with the Igα and Igβ chains, which contain the immunoreceptor tyrosine-based activation motifs at the cytoplasmic region 15. Upon BCR stimulation, the tyrosine kinase Syk is recruited to the tyrosyl-phosphorylated immunoreceptor tyrosine-based activation motifs in Igα and Igβ cytoplasmic tails, followed by phosphorylation of a B cell linker protein BLNK, also known as SH2 domain–containing leukocyte protein of 65 kD (SLP-65), B cell adaptor containing SH2 domain (BASH), and BCA (for a review, see reference 16). Phosphorylated BLNK interacts with several signaling molecules, resulting in regulation of membrane-associated and soluble inositol polyphosphates and Ras–mitogen-activated protein (MAP) kinase cascades 16. The pre-BCR may mediate multiple effector pathways responsible for the pre-B transition, probably through Syk, BLNK, and phosphatidylinositol 3-kinase (PI-3K) 17,18,19,20,21,22,23; however, the regulatory mechanism of the pre-B transition by these molecules remains unclear.

Ras controls multiple signaling pathways by activation of PI-3K and the guanine nucleotide exchange factors for Ral, in addition to activation of Raf/MAP kinase kinases/extracellular signal–regulated kinase (ERK) 24. The activity of p21rasin early B cell development has been previously characterized by the expression of a dominant-inhibitory mutant of Ha-ras (Asn-17 Ha-ras; reference 25) in the earliest B cell precursors under the control of the proximal lck promoter and IgH intronic enhancer (Eμ) 26. High dose expression of Asn-17 Ha-ras caused a reduction in the number of the earliest recognizable B cell precursors and almost complete loss of pro-B and pre-B cells in the BM. This maturation arrest was partially rescued by expression of an activated form of Raf-1, suggesting a role for the Ras-Raf-1–mediated signaling cascade in the progression of differentiation from the earliest B cell precursors to the pro-B stage 26. In addition, expression of constitutively activated p21ras may result in developmental progression of the mutant pro-B cells in the absence of the H chain or recombination activating gene (RAG)-1, supporting the idea that p21ras could be involved in the signal cascade mediated by the pre-BCR 27,28. However, the role for Ras in the progression of differentiation from the pro-B stage at physiological conditions remained to be elucidated.

In this study, we established transgenic mice (TG) that express Asn-17 Ha-ras under control of the IgH promoter, Eμ, and the 3′ Igκ enhancer (3′ Eκ). In agreement with the previous observation that the reporter gene linked to 3′ Eκ was transcriptionally activated at late-stage pro-B cell development 29, Asn-17 Ha-ras was fully expressed in B lineage cells after the early B cell precursor stage. Through the analysis of B cell development in the BM of TG, we demonstrated the novel finding that p21rasactivity could be essential for pre-B cell survival, but not for proliferation of cells during the transition from the pro-B to early pre-B stages.

Establishment of Asn-17 Ha-ras TG.

The plasmid containing Asn-17 Ha-ras was a gift of Dr. G.M. Cooper (Dana-Farber Cancer Institute, Boston, MA). The coding region of Asn-17 Ha-ras was amplified by PCR, and the 0.6-kb DNA fragment was subcloned in the expression vector containing the promoter of the VH186.2 gene 30, Eμ (EcoRI–XbaI 0.8-kb fragments), 3′ Eκ (XbaI–SacI 0.8-kb fragments), SV40 intron (small t antigen), and polyA signals. The final construct was microinjected into pronuclei of C57BL/6 fertilized eggs. We bred transgene-positive founder mice with C57BL/6 mice, and established three independent transgenic lines, designated N-17-52, N-17-75, and N-17-95. These lines were maintained by breeding of heterozygous TG with nontransgenic littermates in sister–brother mating. To establish double TG, we crossed TG from N-17-95 with those from either N-17-52 or N-17-75. To determine the genotypes of offspring of littermates, we purified tail DNA and provided for Southern blot analysis by using HindIII as restriction enzyme and a 1.5-kb DNA fragment of SV40 polyA signal as a probe. In addition, the bcl-2 transgene was introduced into the background of Asn-17 Ha-ras by crossing N-17-95 TG with Bcl-2 TG, which were purchased from The Jackson Laboratory.

FACS® Analysis.

To analyze the early B cell precursors, BM cells were incubated with biotinylated anti-μ, anti-δ, anti-CD23 (BD PharMingen), antisyndecan (BD PharMingen), anti-NK1.1 (BD PharMingen), antierythroblasts (TER119), and anti–Gr-1 (BD PharMingen) mAbs. After washing, we stained cells with allophycocyanin (APC)-coupled B220 (B220APC; BD PharMingen), FITC-conjugated anti-CD43 (CD43FITC; BD PharMingen), and PE-coupled anti-CD24 (heat-stable antigen [HSA]PE) mAbs (BD PharMingen). To analyze pro-B cells, we stained BM cells with B220APC, CD43FITC, PE-coupled anti–BP-1/6C3 (BP-1PE; BD PharMingen), and biotinylated anti-CD24 mAbs. To analyze pre-B cells, we incubated BM cells with biotinylated mAbs (anti-μ, anti-δ, anti-CD23, anti-NK1.1, antierythroblasts, and anti–Gr-1), followed by staining with anti-B220APC, anti-CD43FITC, and anti–BP-1PE mAbs. After washing, cells were incubated with Texas red–coupled UltraAvidin (avidinTEX; Leinco Technologies, Inc.). To analyze immature and circulating B cells in the BM, we stained cells with anti-B220APC, anti-HSAPE, biotinylated anti-CD23, FITC-coupled anti-μ (anti-μFITC), and anti-δFITC mAbs, followed by incubation with avidinTEX. Cells were resuspended in staining buffer containing propidium iodide (5 μg/ml) and analyzed with a FACS Vantage™ (Becton Dickinson) equipped with appropriate filters for five-color analysis in a dual argon laser (488 nm)/dye laser (599 nm) system 30.

Analysis of pre-BCR Expression.

BM cells were stained with ethidium monoazide (EMA; Molecular Probes) and a mixture of anti-μFITC, anti-δFITC, anti-CD23FITC, anti-B220TEX, and BP-1PE mAbs. After washing, the cells were left for 20 min under UV light for irreversible photolytic coupling of EMA to the cellular DNA. Thereafter, the cells were washed with PBS and fixed with 2% formaldehyde for 30 min at room temperature. The cells were then washed and permeabilized with a solution of 0.5% saponin in PBS containing 1% BSA, 0.25 mM EDTA, and 10 mM Hepes, together with 100 μg/ml of 2.4G2 and MOPC21, followed by staining in combination with biotinylated mAb SL156 31 at the first step, and streptavidin-coupled APC at the second step.

Cell Cycle Analysis.

BM cells were stained with EMA and with B220FITC and anti-HSAPE mAbs. After washing, the cells were left under UV light, washed, and fixed with 2% formaldehyde. The cells were then extensively washed and permeabilized with 0.5% saponin, followed by incubation for 30 min with Hoechst 33342 (1 μg/ml; Sigma-Aldrich) at room temperature. DNA contents were analyzed with a FACS Vantage™ equipped with the appropriate filters for four-color analysis in a dual argon laser (488 nm)/UV laser (351/360 nm) system. Excitation of the Hoechst 33342 was carried out by UV light with a maximum wavelength of 351/360 nm, and fluorescence of the Hoechst 33342 was achieved by UV transmission at 424 ± 22 nm.

Purification of BM B Cells.

To enrich B cells, we incubated BM cells with biotinylated mAbs (anti–Gr-1, anti–Mac-1, anti-NK1.1, and anti-CD90). After washing, cells were incubated with streptavidin-coated microbeads and separated on a MACS column (Miltenyi Biotec). To purify pre-B cells and recirculating B cells, we stained enriched B cells with anti-B220APC, anti-HSAPE, anti-μFITC, anti-δFITC, and anti-CD23FITC mAbs. To purify early B cell precursors, we stained enriched B cells with anti-B220APC, anti-CD43FITC, and anti-HSAPE mAbs and with a mixture of biotinylated mAbs (antisyndecan, anti-μ, anti-δ, and anti-CD23). To purify pro-B cells, we stained BM cells with anti-B220APC, anti-CD43FITC, biotinylated anti-HSA, and anti–BP-1PE mAbs. After washing, cells were incubated with avidinTEX. Viable cells were sorted under the forward and side scatter lymphocyte gate on a FACS Vantage™. Reanalysis of sorted pre-B cells showed a purity between 89 and 94%.

Analysis of Pre-B Cell Proliferation.

To detect the uptake of 5-bromo-2′-deoxyuridine (BrdU) by BM B cells, mice were injected intraperitoneally with a single dose of 1 mg BrdU (Sigma-Aldrich). After injection, pre-B cells were purified from individual animals by FACS® sorting and provided for staining with or without FITC-conjugated anti-BrdU mAb (Becton Dickinson), as described previously 30, or with or without mouse anti-BrdU mAb (Oncogene Research Products), followed by staining with affinity-purified goat anti–mouse IgG Fc fragments that were conjugated with FITC (American Qualex). After washing, cells were incubated with anti-B220APC mAb and propidium iodide. For staining controls, the same staining procedure was undertaken for pre-B cells that were purified from C57BL/6 mice and a B cell lymphoma, WEHI231, that was labeled in vitro with or without BrdU. The samples were examined by confocal laser microscopy (LSM410 Laser Scan microscope; Carl Zeiss, Inc.).

Cell Culture.

We enriched B cells from pooled spleens of TG and littermate controls (LM) from N-17-95 using a MACS system. 5 × 106 enriched B cells (>90% B220+) were cultured in the presence or absence of affinity-purified F(ab′)2 goat anti-μ antibody (Jackson ImmunoResearch Laboratories) or anti-CD40 mAb (BD PharMingen), as described previously 11. After several time points, cells were harvested and subjected to Western blot analysis for detection of Bcl-xL.

Western Blot Analysis.

Cells were lysed in RIPA buffer for analysis of p21ras, or in a buffer containing 1% NP-40, 137 mM NaCl, 1 mM MgCl2, 0.1 mM CaCl2, 20 mM Tris-HCl (pH 9.0), 10% glycerol, 0.3 mg papain, 30 μg/ml pancreas extract, 2 μg/ml chymotrypsin, 0.5 μg/ml thermolysin, 20 μg/ml trypsin for analysis of Bcl-xL. The same amount of protein in each sample was separated by SDS-PAGE on a 12 or 15% gel and transferred to a polyvinylidene (PVDF) membrane (Millipore). Blots were incubated with rat anti-Ras mAb (Y13-259; a gift from Dr. Nakafuku, Nara Institute of Science and Technology, Ikoma, Japan), mouse anti-Ras mAb (Ab-3; Oncogene Research Products), or mouse anti–Bcl-x mAb (Transduction Laboratories). After washing, blots were incubated with anti–rat Ig or anti–mouse Ig antibody coupled with peroxidase (Amersham Pharmacia Biotech). After washing, p21ras or Bcl-xL was visualized by the ECL system (Amersham Pharmacia Biotech) as described previously 32. In addition, the blot was probed with mouse anti–β-tubulin mAb (Sigma-Aldrich).

In Vitro MAP Kinase Assay.

Resting B cells were purified from pooled spleens of Asn-17 Ha-ras TG and age-matched wild-type C57BL/6 mice and stimulated with F(ab′)2 goat anti–mouse IgM polyclonal antibody (Jackson ImmunoResearch Laboratories). These cells were provided for an in vitro kinase assay for endogenous ERK activity, as described previously 32.

Semiquantitation of mRNA by Reverse Transcription PCR.

Messenger RNA of sorted cells was purified, and first-strand cDNA was synthesized. Aliquots of cDNA were serially diluted fivefold and provided for reverse transcription (RT)-PCR by using a Premix Taq (Takara Shuzo Co., Ltd.) or Super Taq Premix (Sawady Technology). As a control, β-actin cDNA was amplified by primers CCTAAGGCCAACCGTGAAAAG and TCTTCATGGTGCTAGGAGCCA. H-ras cDNA was amplified by a set of primers, TGACCATCCAGCTGATCCAG and TTGCAGCTCATGCAGCC. In some experiments, additional amplification was performed by using nested primers TGCCATCAACAACACCAAG and GCAGCCAGGTCACACTGGT. The reaction conditions used for each primer set were as follows: β-actin, 94°C for 1 min, 58°C for 1 min, and 72°C for 1.5 min, 40 cycles; H-ras and H-ras nested, 94°C for 1 min, 60°C for 1 min, 72°C 1.5 min, 45 cycles and 25 cycles, respectively.

Semiquantitation of Rearranged Igκ Gene by PCR.

High molecular mass genomic DNA was extracted by the proteinase K method from purified pre-B cells. The PCR cycle was repeated 26–32 times. PCR reactions were performed to detect rearrangements of Igκ as described previously 33. PCR products were detected by Southern blot hybridization to specific radiolabeled Jκ probe (1.7-kb SphI–PstI fragment) or ethidium bromide staining. To detect bcl-6, we used the following set of primers: mBCL-6EX5, 5′-GGCTCAATAATCTCGTGAAC-3′, and mBCL-6EX6, 5′-AGTGACTCTCACTGCTGCTT-3′.

Establishment of TG Expressing Asn-17 Ha-ras Transgene in B Cells.

We constructed the transgene by insertion of the dominant-inhibitory mutant of Asn-17 Ha-ras 25 in an expression cassette consisting of the VH gene promoter (Vp), Eμ, and 3′ Eκ (Fig. 1 A). The transgene was injected into fertilized eggs of C57BL/6 mouse origin, and three independent transgenic lines, designated N-17-52, N-17-75, and N-17-95, were analyzed. As shown in Fig. 1 B, RT-PCR analysis showed the greater expression of ras transcripts in pre-B (top) and pro-B cells (middle) in TG from line N-17-95 than LM. In contrast, this transcript was undetectable in early B cell precursors (bottom, a) without additional amplification by nested PCR (bottom, c). These results suggested that the transgene could be fully activated in BM B cells after the early B cell precursor stage.

Immunoblot analysis showed a remarkable expression of p21ras in pre-B and circulating B cells in the BM of N-17-95 TG, ∼10-fold above the level of LM (Fig. 1 C). Fig. 1 D shows the expression of p21ras in splenocytes in N-17-75 and N-17-95 TG, approximately fivefold above the level of LM, and, to a lesser extent, in N-17-52 TG (top). The level of p21ras expression was low in the thymus of TG and LM, except for TG from N-17-75 (bottom). These results suggest that transgenic B cells expressed p21Asn-17 Ha-ras exceeding the level of endogenous p21ras.

Fig. 1 E shows that ERK activation by IgM stimulation was reduced in resting B cells of TG from line N-17-95 by 30–50% of the wild-type C57BL/6 B cells. Similar results were obtained by analysis of resting B cells of TG N-17-52 and N-17-75 (data not shown), suggesting that expression of p21Asn-17 Ha-ras may significantly inhibit endogenous p21ras activity in B cells.

Expression of Asn-17 Ha-ras Transgene Preferentially Reduced the Number of Pro-B Cells and Late Pre-B Cells in the BM.

As shown in Fig. 2, we evaluated B cell development in the BM of Asn-17 Ha-ras TG by five-color flow cytometry 30, according to the strategy established by Hardy and colleagues 2,3. To analyze early B cell precursors (B220dullCD43+HSAdull), we excluded non-B lineage cells, Ig+ cells, and plasma cells in B220dull/+ cells (Fig. 2 a), and monitored CD43+HSAdull cells (Fig. 2 b). To analyze pro-B cells (B220dullCD43dullHSA+), we gated B220dull HSA+/high BM cells that consisted of pro-B cells, pre-B cells, and immature B cells (Fig. 2 d). Subsequently, CD43+/dullHSA+ cells were gated in a B220dullHSA+/high population (Fig. 2 e), and BP-1 pro-B cells were analyzed (Fig. 2 f). To analyze pre-B cells (B220dullCD43dull/− HSAhigh), we excluded immature and mature B cells and non-B lineage cells (Fig. 2 g) and monitored B220dullCD43dull/− cells (Fig. 2 h), which can be divided into BP-1 and BP-1+ fractions (Fig. 2 i).

TG at ages between 10 and 15 wk from N-17-95 (Fig. 2 and Fig. 3 A), N-17-75 (Fig. 3 B), and N-17-52 (Fig. 3 C) displayed a reduction in the number of pro-B cells by 40–50% of LM. The number of early B cell precursors was comparable between TG and LM, consistent with the results illustrated in Fig. 1 B. Among pre-B cell subsets, TG from N-17-95 and N-17-75 reduced the number of BP-1 cells, four- to fivefold below the level of LM, more prominently than the reduction in the number of BP-1+ cells (Fig. 3A and Fig. B). A similar phenotype was observed in N-17-52 TG, although the reduction in pre-B cells was less marked (Fig. 3 C). Preferential reduction in the number of pro-B and BP-1 pre-B cells was also observed in young N-17-95 TG (Fig. 3 D). RT-PCR analysis suggested that transgenic BP-1+ and BP-1 pre-B cells expressed Asn-17 Ha-ras transcripts at comparable levels (data not shown), excluding the possibility that preferential reduction in the number of BP-1 pre-B cells was due to high levels of transgene expression in this subset.

We crossed N-17-95 TG with either N-17-52 or N-17-75 and analyzed B cell development in the BM of the offspring of the littermates (Fig. 4). The reduction in the number of B cells was dose sensitive, except for the early B cell precursors (pre–pro-B) that almost sustained the number at comparable levels in single and double TG as well as LM. The dose effect was more pronounced in N-17-95/N-17-75 double TG (Fig. 4 B) than in N-17-95/N-17-52 double TG (Fig. 4 A). Although the number of BP-1+ pre-B cells was reduced in N-17-95/N-17-75 double TG, by 3-fold below that of LM, the reduction in the number of pro-B and BP-1 pre-B cells was more prominent, 15- and 30-fold below the level in LM, respectively (Fig. 4 B). Thus, a preferential reduction in the number of BP-1 cells in pre-B cell subsets was a common feature in animals that expressed the Asn-17 Ha-ras transgene at different doses.

BP-1 is expressed at the pro-B to pre-B transition, whereas the expression is downregulated at the pre-B to immature B transition 2,34. We observed that 30–50% of BP-1+ pre-B cells were labeled with BrdU by a single injection of the reagent, three- to fourfold above the level of BP-1 pre-B cells (data not shown). Assuming that BP-1+ and BP-1 cells could be enriched by early and late pre-B cells, respectively, we investigated whether pre-B cells were more susceptible at the late stage than at the early stage to any effect caused by inhibition of p21ras activity. As shown in Fig. 5 A, we analyzed the expression of pre-BCR in IgCD23B220dull B cells of N-17-95 TG, N-17-95/N-17-52 double TG, and nontransgenic LM by using mAb SL156 31, which recognizes a conformational epitope on the μ and SL chain complexes. IgCD23B220dull B cells contained pre-B cells and small numbers of pro-B and the earliest B cell precursor cells (data not shown).

As shown in Fig. 5 B, pre-BCR+ cells were detected in the BP-1+ and BP-1 subsets of the B220dullIgCD23 B cells. Because the pre-BCR is transiently expressed at the late pro-B to early pre-B transition 35, we speculated that pre-BCR+BP-1 cells would be at the late pro-B stage, in the process of maturation to BP-1+ pre-B cells. The number of pre-BCRBP-1 cells was prominently reduced by the expression of Asn-17 Ha-ras transgene in a dose-dependent manner, whereas a reduction in the number of pre-BCR+ and pre-BCR BP-1+ cells was less marked. Because pre-BCR+ pre-B cells enter the S phase of cell cycle at a high frequency 35, these results support the notion that inhibition of p21ras activity does not have much effect on proliferating cells at the late pro-B to the early pre-B transition.

The BP-1+ cells consisted of a minor population in immature B cells at comparable levels between LM and TG from N-17-95 or N-17-95/N-17-52 (data not shown), excluding the possibility that inhibition of p21ras caused an abnormality in the expression of BP-1. In addition, we did not detect any B cells with an aberrant phenotype in either the BM or spleen of the TG within the limitations of the FACS® analysis.

Inhibition of p21ras Activity Caused a Short Life Span of Pre-B Cells.

B cells proliferate efficiently at the transition from pre-BCR+ pre-B to large pre-B cells 35, resulting in a substantial expansion of cell population size 35,36. To investigate the role of p21ras in pre-B cell proliferation, we analyzed the DNA content of B220dullHSA+/high B cells in the BM of N-17-95 TG, N-17-95/N-17-52 double TG, and LM using flow cytometry (Fig. 6A and Fig. B). As summarized in Fig. 6 C, 13–30% of B220dullHSA+/high B cells entered the S phase of cell cycle in the BM of LM, at a comparable level to that of pre-B cells 35. Although B220dullHSA+/high B cells in TG and LM were composed of pre-B cells, immature B cells, and pro-B cells (83–86, 12–15, and 1.3–3%, respectively), proliferating B220dullHSA+/high cells could comprise largely pre-B cells, because immature B cells are mostly at a resting state in TG and LM (36; data not shown). As shown in Fig. 6 C, the number of proliferating cells was reduced in N-17-95 TG, by 60% of LM, whereas the reduction in the number of resting B220dullHSA+/high cells was more significant, threefold below the level found in LM. As shown in Fig. 6D and Fig. E, the number of resting B220dullHSA+/high cells was remarkably reduced in N-17-95/N-17-52 double TG, seven- to eightfold below the level in LM. In contrast, the number of cycling B220dull HSA+/high cells was almost comparable between N-17-95 TG and N-17-95/N-17-52 double TG. These results raised the possibility that the late pre-B transition, but not the early pre-B transition, could be highly susceptible to an effect caused by the inhibition of p21ras activity.

As shown in Fig. 6 F, to investigate further the role of p21ras in the proliferation and accumulation of pre-B cells, we injected a single dose of BrdU into TG and LM from N-17-95. Pre-B cells were purified from the BM of individual animals at 2, 40, and 62 h after injection and stained with anti-BrdU mAb, followed by examination under confocal microscopy 30. In agreement with the results depicted in Fig. 6B and Fig. D, the number of pre-B cells incorporating BrdU 2 h after injection was comparable between TG and LM, whereas in TG the number of nonlabeled pre-B cells was reduced approximately fourfold below that of LM (Fig. 6 F, a). BrdU-labeled pre-B cells increased in number in the BM of LM 40 h after injection (Fig. 6 F, b), indicating accumulation of pre-B cells after several successive proliferations at the transition from late pro-B to early pre-B cells 35,36. The number of labeled cells in TG was half that in LM 40 h after injection (Fig. 6 F, b), followed by a remarkable reduction in number 62 h after injection, ∼10-fold below the level of LM (Fig. 6 F, c), suggesting that inhibition of p21rasactivity may affect the life span of pre-B cells. The number of labeled cells in the immature B cells was significantly low in TG relative to LM 40 and 62 h after injection (data not shown), excluding the possibility that transgenic pre-B cells progress to the stage of immature B cells within periods shorter than required for the cells in the LM.

Expression of Bcl-xL Was Downregulated in Transgenic Pre-B Cells.

Bcl-xL plays a critical role in regulating pre-B cell survival 9,10,11. To investigate whether the short life span of transgenic pre-B cells might reflect the low levels of Bcl-xL expression, we analyzed the expression by Western blotting analysis in pre-B cells that were purified from the pooled BM of TG and LM of N-17-95. Fig. 7 A shows that pre-B cells expressed Bcl-xL, as previously reported 11, and the level of expression was reduced in transgenic pre-B cells, two- to threefold below the level in LM. RT-PCR analysis showed that BP-1+ and BP-1 pre-B cells expressed bcl-xL transcripts at comparable levels in both N-17-95 TG and LM, but the level of expression was significantly low in TG relative to LM (data not shown). These results support the notion that p21rasactivity is associated with pre-B cell survival, at least in part through regulation of Bcl-xL expression.

Bcl-xL expression reaches its maximum at the small pre-B stage 10. Although the mechanism responsible for upregulation of Bcl-xL at the pre-B stage remains unknown, pre-BCR–mediated signaling would be one of the candidate elements. Considering that the pre-BCR and BCR may activate several common signaling molecules 37, including Ras 27,28, we set out to determine to what extent the expression of p21Asn-17 Ha-ras has an inhibitory effect in the upregulation of Bcl-xL in transgenic B cells via BCR stimulation. As reported previously 11, the expression of Bcl-xL proteins was upregulated in B cells upon IgM stimulation (Fig. 7 B); however, the level was reduced in transgenic B cells to approximately two- to threefold below that of LM. In addition, the expression of Bcl-xL mediated by CD40 was reduced by the expression of p21Asn-17 Ha-ras(Fig. 7 B, d). These results suggest that p21ras may play a role in Bcl-xL expression in B cells mediated by extracellular stimuli, which might occur at the pre-B stage.

Coexpression of Bcl-2 Restored the Number of Late Pre-B Cells in Asn-17 Ha-ras TG.

The results illustrated in Fig. 6 and Fig. 7 A are compatible with the view that reduction in the number of late pre-B cells in Asn-17 Ha-ras TG may reflect an abnormality in pre-B cell survival. Because Bcl-2 and Bcl-xL may inhibit cell death through a common pathway (for a review, see reference 38), we examined whether introduction of bcl-2 into the background of Asn-17 Ha-ras transgene might rescue the reduction in the number of pro-B and BP-1 pre-B cells (Fig. 6C and Fig. D).

We observed that the number of early B cell precursors was indistinguishable between offspring of crosses between N-17-95 and Bcl-2 TG (data not shown). We could draw no definite conclusion on the effect of Bcl-2 in the number of pro-B cells in Asn-17 Ha-ras TG. Bcl-2 TG and Bcl-2/N-17-95 double TG prominently expanded Ig+ B cells with the phenotype HSA+B220dullCD43dull in the BM (data not shown), which caused difficulty in the estimation of pro-B cells, defined as HSA+B220dullCD43dullBP-1 cells (see Fig. 2 B). Although the nature of Ig+HSA+ B220dullCD43dull cells remains unknown at present, these cells were barely detectable in the BM of N-17-95 TG and LM (data not shown).

As depicted in Fig. 7 C and summarized in Fig. 7 D, the number of BP-1 pre-B and immature B cells was comparable between Bcl-2 TG (Fig. 7C, Fig. d and Fig. h, and Fig. D, Fig. d) and LM (Fig. 7C, a and e, and D, a), as reported previously 39. The number of BP-1 pre-B cells was significantly reduced in N-17-95 TG (Fig. 7C and Fig. D, Fig. b), whereas coexpression of Bcl-2 restored the number from 13 to 55% of that in LM, on average (Fig. 7C and Fig. D, Fig. c). The number of pre-BCR+ cells in BP-1+ and BP-1 pre-B cells was almost comparable between Bcl-2/N-17-95 double TG and N-17-95 TG (data not shown), supporting the notion that coexpression of Bcl-2 did not affect the accumulation of pre-B cells at the early stage. The number of immature B cells in Bcl-2/N-17-95 double TG (Fig. 7C, Fig. g, and Fig. D, Fig. c) was approximately twofold above the level in N-17-95 TG (Fig. 7C, Fig. f, and Fig. D, Fig. b); this effect was statistically significant (P < 0.05). Taken together, these results suggest the possibility that overexpression of Bcl-2 in N-17-95 TG may alleviate the reduction in the number of pre-B cells capable of progression to immature B cells.

Maximal induction of IgL rearrangement occurs at the late pre-B cell stage 14. The IgL rearrangement is preceded by an activation of the chromatin structure in the IgL locus sufficient for substrate accessibility, which is probably mediated by signaling through the pre-BCR 12,13,14. To delineate the maturation stage of pre-B cells in Bcl-2/N-17-95 double TG, we analyzed genomic DNA samples from purified pre-B cells by a semiquantitative PCR to measure the relative level of Igκ recombination events. As depicted in Fig. 8, there was no large difference in the relative level of Vκ joining, involving Jκ1, Jκ2, and Jκ4, in pre-B cells that were purified from the BM of N-17-95 TG, Bcl-2 TG, Bcl-2/N-17-95 double TG, and LM. Although semiquantitation of rearranged Igκ gene by PCR does not appear to be very sensitive, these results seem compatible with the notion that expression of Asn-17 Ha-ras in pre-B cells could not much affect the process of IgL rearrangement, and that an overexpression of Bcl-2 in N-17-95 TG restored pre-B cells undergoing IgL rearrangement to a considerable extent. In this regard, however, it has been previously observed that introduction of the activated form of Ha-ras into H chain–deficient mice resulted in an accumulation of peripheral B cells that displayed rearrangement of the Igκ locus 28. These results, taken together, seem compatible with the idea that p21ras mediates progression of B cell differentiation to a stage that is accessible to the machinery for IgL rearrangement, although the activity of p21ras is redundant in function with that of other signaling molecules at the pre-B transition. Therefore, further analysis is needed to clarify this issue.

These studies demonstrate that p21ras is essential for the late pre-B transition and support a role for p21ras in pro-B cell development 26. Thus, p21ras could be involved in signaling cascades that control B cell differentiation at different critical points in the BM, whereas it might not be essential for proliferation of cells at the pro-B to pre-B transition. Ras controls multiple signaling pathways 24, and activation of Raf-1 may have an important role in early B cell development in the BM 26; however, Ras-mediated signaling cascades responsible for the late pre-B transition remain to be specified. Mice disrupted with the p85α subunit of PI-3K displayed B cell deficiency, characteristics of decreased numbers of pre-B cells, and increased numbers of apoptotic cells in cultured B cells 19,20. Because PI-3K is a direct effector of active Ras 40, the similar B cell deficit in the p85α−/− mice and Asn-17 Ha-ras TG led us to speculate that inhibition of PI-3K activation could be a component of the late pre-B deficiency imposed by inhibition of p21ras activity.

These studies suggest that p21ras activity could be associated with pre-B cell survival, at least in part through regulation of Bcl-xL expression. Expression of constitutively active Ha-ras does not cause upregulation of bcl-x transcript in RAG-1–deficient B lineage cells 27, suggesting that p21Ha-ras may not transduce the signal for direct activation of bcl-x at the pro-B stage. Therefore, we speculate that p21ras may modulate the expression of bcl-x in concert with other signaling molecules. Consistent with p21ras activity for pre-B cell survival, overexpression of the antiapoptotic protein Bcl-2 alleviated the reduction in the number of late pre-B cells in Asn-17 Ha-ras transgenic animals, but it did not restore the number of cells to the normal level. Considering that cell survival is regulated by the Bcl-2 member of proteins that consists of anti- and proapoptotic members (for reviews, see references 38 and 41), the results might imply that p21ras provides multiple effector pathways for pre-B cell survival, in addition to regulation of antiapoptotic activity. In this context, it has previously been suggested that p21ras activates Akt/protein kinase B (PKB) kinase via PI-3K and ERK via Raf-1, which control the activity of proapoptotic effects in different types of cells in vitro (for a review, see reference 42). Antiapoptotic molecules may function by inhibiting the process of caspase activation, whereas proapoptotic proteins may independently regulate a common apoptotic pathway or function by heterodimerization with antiapoptotic proteins 38,41. Therefore, it is conceivable that exogenous Bcl-2 activity in Asn-17 Ha-ras TG would be overridden by proapoptotic activity, which could be downregulated by p21ras in pre-B cells in a normal state. Whether p21ras regulates pre-B cell survival through multiple effector pathways remains to be elucidated.

We are grateful to Dr. Hirofumi Nishizumi (University of Tokyo) for his critical review of the manuscript, Drs. G.M. Cooper (Dana-Farber Cancer Institute) and Y. Nakafuku (Nara Institute of Science and Technology, Japan) for reagents, and to Ms. K. Nakano and M. Takizawa for operation of the FACS®.

This work was supported by a grant from the Agency of Technology and Science of the Japanese government to T. Takemori.

Surrogate light chain in B cell development
Adv. Immunol
The regulated expression of B lineage–associated genes during B cell differentiation in bone marrow and fetal liver
J. Exp. Med
Identification of the earliest B lineage stage in mouse bone marrow
Targeted disruption of μ membrane exon causes loss of heavy chain allelic exclusion
A critical role of λ5 protein in B cell development
The role of Igα in precursor B cell transition and allelic exclusion
The cytoplasmic domains of immunoglobulin (Ig)α and Igβ can independently induce the precursor B cell transition and allelic exclusion
J. Exp. Med
Aberrant B cell development and immune response in mice with a compromised BCR complex
Massive cell death of immature hematopoietic cells and neurons in Bcl-x-deficient mice
Frequent aberrant immunoglobulin gene rearrangement in pro-B cells revealed by bcl-xL transgene
Bcl-x exhibits regulated expression during B cell development and activation and modulates lymphocyte survival in transgenic mice
J. Exp. Med
Activation of V kappa gene rearrangement in pre-B cells follows the expression of membrane-bound immunoglobulin heavy chains
EMBO (Eur. Mol. Biol. Organ.) J.
Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin μ chains
Changes in locus-specific V(D)J recombinase activity induced by immunoglobulin gene products during B cell development
J. Exp. Med
Antigen receptor tail clue
Genetic analysis of B cell antigen receptor signaling
Annu. Rev. Immunol
Perinatal lethality and blocked B-cell development in mice lacking the tyrosine kinase Syk
Syk tyrosine kinase required for mouse viability and B-cell development
Xid-like immunodeficiency in mice with disruption of the p85α subunit of phosphoinositide 3-kinase
Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85α
Requirement for B cell linker protein (BLNK) in B cell development
An essential role for BLNK in human B cell development
Abnormal development and function of B lymphocytes in mice deficient for the signaling adapter protein SLP-65
Ras—a versatile cellular switch
Curr. Opin. Genet. Dev.
Inhibition of NIH3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP
Mol. Cell Biol
Control of B cell development by Ras-mediated activation of Raf
EMBO (Eur. Mol. Biol. Organ.) J.
Activated Ras signals developmental progression of recombinase-activating gene (RAG)-deficient pro-B lymphocytes
J. Exp. Med
Induction of Ig light chain gene rearrangement in heavy chain-deficient B cells by activated Ras
Proc. Natl. Acad. Sci. USA.
The Igκ 3′-enhancer triggers gene expression in early B lymphocytes but its activity is enhanced on B cell activation
Int. Immunol
Accumulation of somatic hypermutation and antigen-driven selection in rapidly cycling surface Ig+ germinal center (GC) B cells which occupy GC at high frequency during the primary anti-hapten response in mice
Eur. J. Immunol
Precursor B cells of mouse bone marrow express two different complexes with two surrogate light chains on the surface
Eur. J. Immunol
Tumor necrosis factor receptor–associated factor 6 (TRAF6) stimulates extracellular signal–regulated kinase (ERK) activity in CD40 signaling along a Ras-independent pathway
J. Exp. Med
The PU.1 binding site is a cis-element that regulates pro-B/pre-B specificity of Vκ-Jκ joining
J. Immunol
A novel cell surface molecule on early B-lineage cells
The expression of Vpre-B/λ5 surrogate light chain in early bone marrow precursor B cells of normal and B cell-deficient mutant mice
B cell development in the bone marrow
Semin. Immunol
The Igα/Igβ heterodimer on μ-negative proB cells is competent for transduction signals to induce early B cell differentiation
Bcl-2 familyregulators of cell death
Annu. Rev. Immunol
Developmental regulation of the Bcl-2 protein and susceptibility to cell death in B lymphocytes
EMBO (Eur. Mol. Biol. Organ.) J.
Phosphatidylinositol-3-OH kinase as a direct target of Ras
The Bcl-2 protein familyarbiters of cell survival
Ras signalling and apoptosis
Curr. Opin. Genet. Dev

Abbreviations used in this paper: APC, allophycocyanin; BLNK, B cell linker protein; BM, bone marrow; BrdU, bromodeoxyuridine; EMA, ethidium monoazide; ERK, extracellular signal–regulated kinase; 3′ Eκ, 3′ Igκ enhancer; Eμ, IgH intronic enhancer; HSA, heat-stable antigen; LM, littermate controls; MAP, mitogen-activated protein; PI-3K, phosphatidylinositol 3-kinase; pre-BCR, pre-B cell antigen receptor; RT, reverse transcription; sIg, surface Ig; SL, surrogate L chain; TG, transgenic mice.

H. Nagaoka and Y. Takahashi contributed equally to this work.

H. Nagaoka's current address is Laboratory of Molecular Immunology, The Rockefeller University, 1230 York Ave., New York, NY 10021.